pCS01
(Plasmid #251503)

• Purpose: Tn7-compatible landing pad integration; integrates poly-attB cassette at attTn7
• Depositing Lab: James Carothers
• Depositing Organization: University of Washington
  Located in the United States of America
• Publication: Conjugation-based Serine Recombinase-Assisted Genome Engineering (cSAGE) Enables Bioproduction in Non-model Bacteria (unpublished)

Backbone

• Vector backbone: pUC18T-mini-Tn7T-Gm
• Backbone manufacturer: Herbert Schweizer
• Modifications to backbone: Replaced pUC origin of replication with pR6K
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Gentamicin, 100 & 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SAGE cassette
• Insert Size (bp): 1390

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tctaactaaaaaggcctcccaaatcgg
• 3′ sequencing primer: tgtgaaaaagcccgcgcaag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A C to T mutation at nt 33 of SAGE cassette was found, this does not impact the intended use of the plasmid.

Alternative name: pRC414.v2

Usage/Comments: This plasmid is used to generate a cSAGE-compatible base strain by integrating the poly-attB landing pad cassette into the host genome using a Tn7-based strategy. The landing pad contains multiple orthogonal serine recombinase attachment sites (attB), enabling subsequent site-specific integration of genetic payloads via cSAGE. Once integrated, the host strain becomes compatible with Bxb1, R4, TG1, and other serine recombinases for modular genome engineering. This plasmid is used only for installation of the landing pad and is not required for downstream integration steps after the base strain is constructed. Please visit https://doi.org/10.64898/2026.04.17.717921 for bioRxiv preprint.