Skip to main content

pJW2333
(Plasmid #253924)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253924 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pDONR221
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2356
  • Total vector size (bp) 3566
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    12aa linker::mNeonGreen::TEV::AID*::3xFLAG::12aa linker
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    1221

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
  • 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJW2333 was a gift from Jordan Ward (Addgene plasmid # 253924 ; http://n2t.net/addgene:253924 ; RRID:Addgene_253924)
  • For your References section:

    Multiscale patterning of a model apical extracellular matrix revealed by systematic endogenous protein tagging. Ragle JM, Pooranachithra M, Ashley GE, Cadena E, Blank B, Kang K, Chen C, Bhowmick AR, Mercado SH, Wells TE, Clancy JC, Chisholm AD, Ward JD. bioRxiv [Preprint]. 2025 May 14:2025.05.14.653803. doi: 10.1101/2025.05.14.653803. 10.1101/2025.05.14.653803 PubMed 40463100