pPBG01 Recombination plasmid
(Plasmid
#253997)
-
PurposeInducible lambdaRED for genomic recombination.
-
Depositing Lab
-
Depositing OrganizationNational University of Singapore
Located in Singapore -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneCloDF13
- Backbone size w/o insert (bp) 3008
- Total vector size (bp) 4893
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namelambdaRED
-
SpeciesLambda phage (Addgene #87359)
-
Insert Size (bp)1885
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atggatattaatactgaaactgaga
- 3′ sequencing primer tgtatttggggagcaatggcgatga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPBG01 Recombination plasmid was a gift from Julius Fredens (Addgene plasmid # 253997 ; http://n2t.net/addgene:253997 ; RRID:Addgene_253997) -
For your References section:
Bridging continuous and discrete evolution through a controllable, hypermutagenic phage-bacteria system. Ong S, Ghode P, Narenderan A, Lao S, Willenborg F, Eden TV, Marsh CO, Yew WS, Fredens J. Nat Microbiol. 2026 May 1. doi: 10.1038/s41564-026-02346-y. 10.1038/s41564-026-02346-y PubMed 42067623