Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC19-URA3-3'SEC13-GFP
(Plasmid #25445)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 25445 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19-URA3
  • Backbone size w/o insert (bp) 4500
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Sec13-Green Fluorescent Protein
  • Alt name
    Sec13-GFP
  • Species
    S. cerevisiae (budding yeast); Aequoria victoria
  • Insert Size (bp)
    1200

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (destroyed during cloning)
  • 5′ sequencing primer ggaagggcgatcggtgcgggcctcttcg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-URA3-3'SEC13-GFP was a gift from Benjamin Glick (Addgene plasmid # 25445 ; http://n2t.net/addgene:25445 ; RRID:Addgene_25445)
  • For your References section:

    Golgi structure correlates with transitional endoplasmic reticulum organization in Pichia pastoris and Saccharomyces cerevisiae. Rossanese OW, Soderholm J, Bevis BJ, Sears IB, O'Connor J, Williamson EK, Glick BS. J Cell Biol. 1999 Apr 5. 145(1):69-81. 10.1083/jcb.145.1.69 PubMed 10189369