Skip to main content

pTBL3331 MTK234 hU6-TetO-BtoApegRNA
(Plasmid #254860)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254860 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    MTK234 from Addgene kit #1000000180
  • Backbone manufacturer
    Hana El-Samad
  • Backbone size w/o insert (bp) 1666
  • Total vector size (bp) 2118
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TetO_hU6_promoter-peCHYRON_BtoA_pegRNA
  • gRNA/shRNA sequence
    GCCATCATCACCATCATTGA
  • Species
    H. sapiens (human); Streptococcus pyogenes

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTBL3331 MTK234 hU6-TetO-BtoApegRNA was a gift from Chang Liu (Addgene plasmid # 254860)
  • For your References section:

    Open-ended molecular recording of sequential cellular events into DNA. Loveless TB, Carlson CK, Dentzel Helmy CA, Hu VJ, Ross SK, Demelo MC, Murtaza A, Liang G, Ficht M, Singhai A, Pajoh-Casco MJ, Liu CC. Nat Chem Biol. 2025 Apr;21(4):512-521. doi: 10.1038/s41589-024-01764-5. Epub 2024 Nov 14. 10.1038/s41589-024-01764-5 PubMed 39543397