pTBL3331 MTK234 hU6-TetO-BtoApegRNA
(Plasmid
#254860)
-
PurposeMTK234 part encoding a doxycycline-inducible B-to-A pegRNA for the peCHYRON system. Can be used for transient transfection or incorporated into larger MTK assemblies.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Irvine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneMTK234 from Addgene kit #1000000180
-
Backbone manufacturerHana El-Samad
- Backbone size w/o insert (bp) 1666
- Total vector size (bp) 2118
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetO_hU6_promoter-peCHYRON_BtoA_pegRNA
-
gRNA/shRNA sequenceGCCATCATCACCATCATTGA
-
SpeciesH. sapiens (human); Streptococcus pyogenes
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBL3331 MTK234 hU6-TetO-BtoApegRNA was a gift from Chang Liu (Addgene plasmid # 254860) -
For your References section:
Open-ended molecular recording of sequential cellular events into DNA. Loveless TB, Carlson CK, Dentzel Helmy CA, Hu VJ, Ross SK, Demelo MC, Murtaza A, Liang G, Ficht M, Singhai A, Pajoh-Casco MJ, Liu CC. Nat Chem Biol. 2025 Apr;21(4):512-521. doi: 10.1038/s41589-024-01764-5. Epub 2024 Nov 14. 10.1038/s41589-024-01764-5 PubMed 39543397