E. coli BW25113:PcpcG2-tetR (CMB247)
(Bacterial strain
#254898)
-
PurposeOptogenetic control of TetR expression in bacteria using CcaSR system
-
Depositing Lab
-
Depositing OrganizationBoston University Main Campus
Located in the United States of America -
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Bacterial Strain | 254898 | Bacteria in agar stab | 1 | $94 | |
Backbone
-
Vector backbonen/a
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)BW25113:PcpcG2-tetR (CMB247)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCarries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion.
Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
E. coli BW25113:PcpcG2-tetR (CMB247) was a gift from Mary Dunlop (Addgene plasmid # 254898) -
For your References section:
Dynamic heterogeneity in an E. coli stress response regulon mediates gene activation and antimicrobial peptide tolerance. Blassick CM, Moghimianavval H, Jafarbeglou F, Lugagne JB, Dunlop MJ. Cell Rep. 2026 Apr 16;45(4):117259. doi: 10.1016/j.celrep.2026.117259. 10.1016/j.celrep.2026.117259 PubMed 41996246