Skip to main content

JGE301_pAAV-hSyn-DIO-Flag-hM3Dq-V2(2D)-ABIcs-mCherry
(Plasmid #107246)

  • Purpose
    hM3DREADD fused to ABIcs for abscisic acid mediated recruitment of PYLcs labelled proteins.
  • Depositing Lab
  • Depositing Organization
    University of North Carolina at Chapel Hill
    Located in the United States of America
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107246 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    AAV2
  • Backbone size w/o insert (bp) 6597
  • Total vector size (bp) 8454
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hM3DREADD
  • Alt name
    Gq DREADD
  • Species
    Synthetic
  • Insert Size (bp)
    1776
  • Mutation
    T to D and S to D mutations in V2-tail
  • Promoter hSYN
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • ABIcs (C terminal on insert)
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgctgcctcagtctgcggtg
  • 3′ sequencing primer ggagaaaatgaaagccatacgggaagcaatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/01/22/251769 for bioRxiv preprint.

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JGE301_pAAV-hSyn-DIO-Flag-hM3Dq-V2(2D)-ABIcs-mCherry was a gift from Bryan Roth (Addgene plasmid # 107246 ; http://n2t.net/addgene:107246 ; RRID:Addgene_107246)
  • For your References section:

    A Chemogenetic Platform for Spatio-temporal Control of β-arrestin Translocation and Signaling at G protein-Coupled Receptors. Roth BL, Gotoh Y, Giguere P, Nichols D. bioRxiv 251769 /10.1101/251769