pCRISPR_RAF1_94
(Plasmid
#111826)
-
PurposeKnockout Raf1
-
Depositing Lab
-
Depositing OrganizationConcordia University
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 111826-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 111826-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAll_in_one_CRISPR/Cas9_LacZ
-
Backbone manufacturerLynne Postovit (Addgene plasmid # 74293)
- Backbone size w/o insert (bp) 10694
- Total vector size (bp) 10394
-
Modifications to backboneRemoval of LacZ-alpha in the cloning process
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting RAF1 94-114
-
gRNA/shRNA sequenceGCCGCCCGAGAGTCTTAATCG
-
SpeciesH. sapiens (human)
-
Entrez GeneRAF1 (a.k.a. CMD1NN, CRAF, NS5, Raf-1, c-Raf)
- Promoter U6
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer SP6 Forward: ATTTAGGTGACACTATAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 111826-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 111826-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR_RAF1_94 was a gift from Steve Shih (Addgene plasmid # 111826 ; http://n2t.net/addgene:111826 ; RRID:Addgene_111826) -
For your References section:
An automated microfluidic gene-editing platform for deciphering cancer genes. Sinha H, Quach ABV, Vo PQN, Shih SCC. Lab Chip. 2018 Jul 24;18(15):2300-2312. doi: 10.1039/c8lc00470f. 10.1039/c8lc00470f PubMed 29989627
