Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CRISPR Plasmids: gRNAs


The table below lists gRNA plasmids designed to target various genes or genomic regions. It is highly recommended that you determine if your cell type contains the target sequence before using any of these gRNA plasmids and review the publication associated with each plasmid for more information on how it was originally used.

Here are a few questions to consider when choosing a gRNA:

  • Does a given gRNA sequence exactly match your genomic target? Variation between a given gRNA sequence and your genomic target may reduce the gRNA activity. The variety in sequence decreases the gRNA activity and increases off-target effect.
  • Which species or variant of Cas9 (S. pyogenes, S. aureus etc.) was this gRNA sequence designed for? A given gRNA sequence may only be compatible with a single species or PAM binding variant of Cas9. For instance, wild-type SpCas9 must be used with targets that are upstream of a 5' NGG 3' PAM sequence.
  • Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets within promoters.

Do you have gRNAs you'd like to add to the Addgene collection? Click here to start the deposit process and have your plasmids added to the list. You can also email [email protected] for more information and assistance with the deposit process.


gRNA Plasmids

Please note that the following table lists both published and unpublished plasmids containing gRNA sequences designed to be used with any CRISPR nuclease and function. Please see the publication or plasmid information page, or contact the depositing PI for more information on the experimental use of these plasmids.

Plasmid Gene/Insert Vector Type PI Publication
gRNA_AAVS1-T1gRNA_AAVS1-T1Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_AAVS1-T2gRNA_AAVS1-T2Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_GFP-T1gRNA_GFP-T1Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_GFP-T2gRNA_GFP-T2Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_DNMT3a-T1gRNA_DNMT3a-T1 (Homo sapiens)Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_DNMT3a-T2gRNA_DNMT3a-T2 (Homo sapiens)Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_DNMT3bgRNA_DNMT3b (Homo sapiens)Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
Zebrafish-gRNA-0001gRNA-apoea (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0002gRNA-drd3 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0003gRNA-fh site #1 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0004gRNA-fh site #2 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0005gRNA-gsk3b (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0006gRNA-rgs4 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0007gRNA-th1 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0008gRNA-tia1l (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0009gRNA-tph1a (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-purohumanized S. pyogenes Cas9Mammalian Expression, CRISPR Zhang Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3.
p426-SNR52p-gRNA.CAN1.Y-SUP4tCAN1.y gRNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR Church Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res
pCRISPR::rpsLCRISPR::rpsLCRISPR ; E.coli Marraffini RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2508.
PU6::unc-119_sgRNAunc-119 targeting sgRNA (Synthetic)CRISPR Calarco Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532.
PU6::klp-12_sgRNAklp-12 targeting sgRNA (Synthetic)Worm Expression, CRISPR Calarco Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532.
pT7EGFPgRNAegfp target (Synthetic)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.
pT7tyrgRNAtyr gRNA (Danio rerio)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.
pU6-sgGFP-NT1sgGFP-NT1Mammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pU6-sgGAL4-1sgGAL4-1, Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pU6-sgGAL4-4sgGAL4-4, Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pU6-sgCXCR4-2sgCXCR4 -2 (Homo sapiens), Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pU6-sgCD71-2sgCD71 -2 (Homo sapiens), Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pSNR52-sgTEF1sgTEF1 promoter (Saccharomyces cerevisiae)Yeast Expression, CRISPR Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pSNR52-sgTETsgRNA targeting endogenous TRE elements of pTET07 promoter (Saccharomyces cerevisiae)Yeast Expression, CRISPR Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pICH86966::AtU6p::sgRNA_PDSAtU6p::sgRNA_PDS (Synthetic)CRISPR ; Plant expression Kamoun Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655.
pVC297 VEGF Site#1gRNA-VEGF site 1 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pVC299 VEGF Site#2gRNA-VEGF site 2 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pVC228 VEGF Site#3gRNA-VEGF site 3 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pFYF1548 EMX1gRNA-EMX1 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pDR366 RNF2gRNA-RNF2 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pDR348 FANCFgRNA-FANCF (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pFYF1320 EGFP Site#1gRNA-EGFP site 1 (Synthetic)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pFYF1327 EGFP Site#2gRNA-EGFP site 2 (Synthetic)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pFYF1328 EGFP Site#3gRNA-EGFP site 3 (Synthetic)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pDD122 (Peft-3::Cas9 + ttTi5605 sgRNA)Cas9 (Synthetic), ttTi5605 sgRNA (Other)Worm Expression, CRISPR Goldstein Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641.
pSimpleII-U6-tracr-U6-crRNA(tdTomato)-NLS-NmCas9-HA-NLS(s)NmCas9 (Other), U6pr-tracrRNA (Other), tdTomato crRNA (Synthetic)Mammalian Expression, CRISPR Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12.
pSimpleII-U6-tracr-U6-crRNA(OCT4)-NLS-NmCas9-HA-NLS(s)NmCas9 (Other), U6pr-tracrRNA (Other), OCT4 crRNA (Synthetic)Mammalian Expression, CRISPR Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12.
pSTBlue-U6-sgRNA(tdTomato)sgRNA-tdTomato (Synthetic)Mammalian Expression, CRISPR Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12.
pT7goldRNAgolden gRNA (Danio rerio)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.
pT7mitfagRNAmitfa gRNA (Danio rerio)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.
pT7ddx19gRNAddx19 gRNA (Danio rerio)CRISPR Wente Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.
PM-SP!TABacterial SP crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-SP!TBBacterial SP crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-NM!TABacterial NM crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-NM!TBBacterial NM crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-ST1!TABacterial ST1 crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-ST1!TBBacterial ST1 crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-TD!TABacterial TD crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-TD!TBBacterial TD crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
EE-SP!gIIICas9 (Other), anti-gIII tracrRNA (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
M-SP-sgRNAsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
M-ST1-sgRNAsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
M-NM-sgRNAsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
pAc-y1sgRNA-Cas9Cas9 (Synthetic), dU6-sgRNA (Drosophila melanogaster), y1 sgRNA (Drosophila melanogaster)Insect Expression, CRISPR Liu Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Biol Open. 2013 Dec 10. pii: bio.20137120v1. doi: 10.1242/bio.20137120.
pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1sgRNA_PDS2-Cas9-sgRNA_PDS1 (Synthetic)Plant Expression, CRISPR Kamoun Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 2013 Oct 11;9(1):39.
pLX-sgRNAsgAAVS1Mammalian Expression, Lentiviral, CRISPR Sabatini Genetic screens in human cells using the CRISPR-Cas9 system. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12.
pX330-Cetn1/1Cetn1 sgRNA1 (Synthetic), humanized S. pyogenes Cas9 (Other)Mammalian Expression, CRISPR Ikawa Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355.
pLKO.1-puro U6 sgRNA Oct4A -12Oct4A -12 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA Oct4A -158Oct4A -158 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA SOX17 -91Sox17 -91 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA SOX17 -126Sox17 -126 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA SOX17 -177Sox17 -177 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA SOX17 -296Sox17-296 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA CAGnegative control sgRNA (Other)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pSLQ1651-sgTelomere(F+E)Optimized sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001.
pSLQ1661-sgMUC4-E3(F+E)optimized sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001.
pRS316-RGR-GFPRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.
pRS316-RGR-GFP-mHHRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.
pRS316-RGR-GFP-mHDVRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.
pRS316-RGR-GFP-mmRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.
lentiCRISPR - EGFP sgRNA 1Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 1 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
lentiCRISPR - EGFP sgRNA 2Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 2 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
lentiCRISPR - EGFP sgRNA 3Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 3 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
lentiCRISPR - EGFP sgRNA 4Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 4 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
lentiCRISPR - EGFP sgRNA 5Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 5 (Synthetic)Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
lentiCRISPR - EGFP sgRNA 6Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 6 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
pMZ284rrk1-sgRNA (Schizosaccharomyces pombe)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pMZ285rrk1-sgRNA (Schizosaccharomyces pombe)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pMZ286rrk1-sgRNA (Schizosaccharomyces pombe)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pUC119-gRNAguide RNA targeting AtPDS3 (Arabidopsis thaliana)CRISPR ; Plant expression Sheen Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654.
pSAG1::CAS9-U6::sgUPRTSAG1 5' UTR (Other)CRISPR ; Toxoplasma expression Sibley Efficient Gene Disruption in Diverse Strains of Toxoplasma gondii Using CRISPR/CAS9. MBio. 2014 May 13;5(3). pii: e01114-14. doi: 10.1128/mBio.01114-14.
CMVp-dsRed2-Triplex-28-gRNA1-28-pAdsRed2 (Homo sapiens)Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022.
CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pAdsRed2 (Homo sapiens)Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022.
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pAdsRed2 (Homo sapiens)Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022.
pCCM935unc-22 sgRNA (Caenorhabditis elegans)Worm Expression Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Genetics. 2014 May 30. pii: genetics.114.166389.
pAdSh.U6.gRNAS1U6.gRNAS1 cassette (Synthetic)Mammalian Expression, Adenoviral, CRISPR Goncalves Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105.
pAdSh.U6.gRNAGFPU6.gRNAGFP cassette (Synthetic)Mammalian Expression, Adenoviral, CRISPR Goncalves Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105.
pCCM936avr-14 sgRNA (Caenorhabditis elegans)Worm Expression, CRISPR Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Genetics. 2014 May 30. pii: genetics.114.166389.
pCCM937avr-15 sgRNA (Caenorhabditis elegans)Worm Expression, CRISPR Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Genetics. 2014 May 30. pii: genetics.114.166389.
pXPR_011EGFP sgRNA (Synthetic)Mammalian Expression, Lentiviral, CRISPR Root Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Sep 3. doi: 10.1038/nbt.3026.
Human BLIMP1 sgRNAhBLIMP1 sgRNA (Homo sapiens)Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015
Human SOX17 sgRNAhSox17 sgRNA (Homo sapiens)Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015
Human T (BRACHYURY) sgRNAhT sgRNA (Homo sapiens)Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015
pSAG1::CAS9-U6::sg290860-6CRISPR sg290860-6CRISPR ; ; Toxoplasma gondii Sibley Genetic mapping reveals that sinefungin resistance in Toxoplasma gondii is controlled by a putative amino acid transporter locus that can be used as a negative selectable marker. Eukaryot Cell. 2014 Dec 5. pii: EC.00229-14.
pMZ288Cas9 (Other), rrk1:sgRNA (Other)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pMZ289Cas9 (Other), rrk1:sgRNA (Other)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pMZ381Cas9 (Other), rrk1:sgRNA (Other)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pX330 PtensgRNA targeting Pten (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589.
pX330 p53sgRNA targeting p53 (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589.
pX330 Ctnnb1.1sgRNA targeting Ctnnb1 (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589.
pX330 Ctnnb1.2Ctnnb1 (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589.
pJA45rde-1(D718) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA46rde-1(D801) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA14rde-1(H974) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA42rol-6(su1006) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA50unc-58(e665) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA59unc-109(n499) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA58dpy-10(cn64) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA55sqt-1(e1350) gRNA2 (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
U6>Ebf.774(F+E)Ebf.774 (F+E) sgRNACRISPR Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488.
U6>Control(F+E)Control (F+E) sgRNACRISPR Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488.
RFN_EGFP_47pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
RFN_EGFP_80pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
RFN_EGFP_81pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
RFN_EGFP_82pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
RFN_EGFP_83pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
RFN_EGFP_84pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
pJA54sqt-1(e1350) gRNA1 (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR (AAV-KPL)sgRNA (Synthetic), Renilla luciferase, Cre recombinase, KrasG12D HDR donor (Mus musculus)Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.
AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITRsgRNA, Renilla luciferase, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.
AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITRsgRNA, Cre recombinase, EGFPMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.
pGL3-Basic-8x-gRNA-eGFP8 copies of gRNA binding site (5'-AAAGGTCGAGAAACTGCAAA-3') Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753.
gRNA-eGFP-ReportergRNA (5'-AAAGGTCGAGAAACTGCAAA-3')Mammalian Expression, CRISPR Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753.
pCASS. pyogenese Cas9 (Other), RNA pol III promoter (tRNA-Tyr) (Saccharomyces cerevisiae), hepatitis delta virus ribozyme, genomic (Other), sgRNA (Synthetic)Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology Cate Selection of chromosomal DNA libraries using a multiplex CRISPR system. Elife. 2014 Aug 19;3. doi: 10.7554/eLife.03703.
pLV-sgCDKN1B#2 BFPBFPMammalian Expression, Lentiviral, CRISPR Vale A Protein-Tagging System for Signal Amplification in Gene Expression and Fluorescence Imaging. Cell. 2014 Oct 8. pii: S0092-8674(14)01227-6. doi: 10.1016/j.cell.2014.09.039.
pT7-gRNA:Tyr (albino)Tyrosinase gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
pT7-gRNA:Tyr (wild)Tyrosinase gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
pT7-gRNA:AsipAgouti signaling protein gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
pT7-gRNA:kit-1v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
pT7-gRNA:kit-2-1v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
pT7-gRNA:kit-2-2v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
DR274-eGFP sgRNAEGFP sgRNA (Synthetic)CRISPR Del Bene Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Res. 2014 Jan;24(1):142-53. doi: 10.1101/gr.161638.113. Epub 2013 Oct 31.
gRNA-hIRF-1 #12gRNA_hIRF1 promoter #12 (Homo sapiens)Mammalian Expression, CRISPR Fujii Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochem Biophys Res Commun. 2013 Sep 13;439(1):132-6. doi: 10.1016/j.bbrc.2013.08.013. Epub 2013 Aug 11.
gRNA-hIRF-1 #12/pSIRgRNA_hIRF1 promoter #12 (Homo sapiens)Mammalian Expression, Retroviral, CRISPR Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014.
pJW1219sgRNA(F+E) (Synthetic)Worm Expression, CRISPR Ward Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9. pii: genetics.114.172361.
pJW1285sgRNA(F+E) targeting pha-1 (Synthetic)Worm Expression, CRISPR Ward Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9. pii: genetics.114.172361.
pMM178Cas9, tracrRNA, crRNA (Other)Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011.
pMM441Cas9, tracrRNA, crRNA (Other)Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011.
pRC319Cas9, tracrRNA, crRNA (Other)Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011.
px335 Mettl14 sgRNA #2gccgctcccggatctcctgc (Mus musculus)Mammalian Expression, CRISPR Hanna m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015
px335 Mettl14 sgRNA #1gcggcagctcctagctcagc (Mus musculus)Mammalian Expression, CRISPR Hanna m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015
px330-USP13USP13 (Homo sapiens)CRISPR Ye USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14.
px330-gp78gp78 (Homo sapiens)CRISPR Ye USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14.
MLM3636-Prnp-CDS-NegPrP guiding sequence (Mus musculus)Mammalian Expression, CRISPR Schmitt-Ulms CRISPR-Cas9-Based Knockout of the Prion Protein and Its Effect on the Proteome. PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014.
MLM3636-Prnp-CDS-PosPrP guiding sequence (Mus musculus)Mammalian Expression, CRISPR Schmitt-Ulms CRISPR-Cas9-Based Knockout of the Prion Protein and Its Effect on the Proteome. PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014.
pTargetFsgRNA (Synthetic)Bacterial Expression, CRISPR Yang Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14.
pAN-PBAD-sgRNA-A1NTA1NT (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A1TA1T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A2NTA2NT sgRNABacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A2TA2T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A3NTA3NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A3TA3T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A4NTA4NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A4TA4T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A5NTA5NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A5TA5T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-scramblescramble sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-VRVR sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-NORA2NT sgRNA (Synthetic), A2NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-ANDA1NT sgRNA (Synthetic), A4NT sgRNA (Synthetic), A2NT sgRNA (Synthetic), A1NT (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-OR-MalT-3NTA2NT sgRNA (Synthetic), Malt-3NT sgRNA (Synthetic), A2NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pJZC545sgRNA + 1x MS2 binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC583sgRNA + 2x MS2 binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC588sgRNA + 2x MS2 (wt+f6) binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC548sgRNA + 1x PP7Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC603sgRNA + 2x PP7 RNA binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC572sgRNA + 1x com RNA binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC593sgRNA + MS2-PP7 RNA binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC523sgRNAYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC625sgRNA +1x MS2, Pol II promoter with ribozyme cleavageYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC35sgRNAMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC32sgRNA, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC25sgRNA + 1x MS2 binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC33sgRNA + 2x MS2 binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC34sgRNA + 2x MS2(wt+f6) binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC41sgRNA, PCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC39sgRNA + 1x PP7, mCherryMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC40sgRNA + 2x PP7, mCherryMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC101sgRNA, COM-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC48sgRNA + 1x COM binding module, COM-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC102sgRNAMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC77sgRNA, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC78sgRNA + 1x COM binding module, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC103sgRNAMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC73sgRNA, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC74sgRNA + 1x COM binding module, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC116sgRNA + 2x MS2 (wt+f6) binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pKCcas9dOScocas9 (Other), sgRNA (), act-orf4 homology armBacterial Expression, CRISPR ; Bacterial Genome Editing Jiang One-step high-efficiency CRISPR/Cas9-mediated genome editing in Streptomyces. Acta Biochim Biophys Sin (Shanghai). 2015 Apr;47(4):231-43. doi: 10.1093/abbs/gmv007. Epub 2015 Mar 3.
LentiCRISPR_Hs_MBD3_ex2MBD3 gRNA (Homo sapiens)Lentiviral, CRISPR Wade LentiCRISPR_Hs_MBD3_ex2 (unpublished)
LentiCRISPR_Hs_MBD3_ex3MBD3 gRNA (Homo sapiens)Lentiviral, CRISPR Wade LentiCRISPR_Hs_MBD3_ex2 (unpublished)
ptreCas9-mKate2ps-T1gRNACas9–mKate2ps (Synthetic)Mammalian Expression Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.
pCas9–mKate2ps–T1gRNACas9–mKate2ps (Synthetic)Mammalian Expression Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.
pX330_sgACTA2ACTA2 (Homo sapiens)Mammalian Expression Qi Small Molecules Enhance CRISPR Genome Editing in Pluripotent Stem Cells. Cell Stem Cell. 2015 Feb 5;16(2):142-7. doi: 10.1016/j.stem.2015.01.003.
PX458_CEBPB_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_CEBPB_2gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_RAD21_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
Adeno EAU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9 (Mus musculus)Adenoviral Ventura In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22.
sgRNA1_ASCL1sgRNA1_ASCL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA2_ASCL1sgRNA1_ASCL2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA3_ASCL1sgRNA1_ASCL3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA4_ASCL1sgRNA1_ASCL4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA2_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA3_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA4_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_IL1RNIL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA2_IL1RNsgRNA2_IL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA3_IL1RNsgRNA3_IL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA4_IL1RNsgRNA4_IL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_NANOGsgRNA1_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA2_NANOGsgRNA2_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA3_NANOGsgRNA3_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA4_NANOGsgRNA4_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_GAL4UAS-Luciferase reportersgRNA1 for GAL4UAS-Luciferase reporter (Synthetic)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA2_GAL4UAS-Luciferase reportersgRNA2 for GAL4UAS-Luciferase reporter (Synthetic)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA3_GAL4UAS-Luciferase reportersgRNA3 for GAL4UAS-Luciferase reporter (Synthetic)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_pNeurog2-Luciferase reportersgRNA1 for pNeurog2-Luciferase reporter (Synthetic)Mammalian Expression, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_Tet-inducible Luciferase reportersgRNA1 for Tet-inducible Luciferase reporter (Synthetic)Mammalian Expression, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
pU6-sgRosa26-1_CBh-Cas9-T2A-BFPCas9 (Other), sgRNA targeting ROSA26-1Mammalian Expression, CRISPR Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1BCas9 (Other), sgRNA targeting ROSA26-1Mammalian Expression, CRISPR Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.
pU6a:sgRNA(tyr)U6a:sgRNA (tyr) (Danio rerio)CRISPR Chen Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 2015 Apr 8. pii: genetics.115.176917.
PX458_GABPA_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_GABPA_2gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
gRNA-ura-HYBgBlock product of ura3 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3.
gRNA-trp-HYBgBlock product of trp1 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3.
gRNA-leu-HYBgBlock product of leu2 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3.
gRNA-his-HYBgBlock product of his3 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3.
pRPR1_a1gRNA_RPR1ta1 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c1gRNA_RPR1tc1 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c2gRNA_RPR1tc2 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c3gRNA_RPR1tc3 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c4gRNA_RPR1tc4 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c5gRNA_RPR1tc5 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c6gRNA_RPR1tc6 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c7gRNA_RPR1tc7 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c8gRNA_RPR1tc8 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_g1gRNA_RPR1tg1 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_g2gRNA_RPR1tg2 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
PX458_ATF1_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_CREB1_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_CREB1_2gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
pCas9–mKate2ps–CgRNACas9–mKate2psMammalian Expression Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.
pT7-th-sgRNAth sgRNA (Danio rerio)in vitro RNA transcription Du Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system. Cell Res. 2015 Apr 7. doi: 10.1038/cr.2015.43.
pT7-gfap-sgRNAgfap sgRNA (Danio rerio)in vitro RNA transcription Du Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system. Cell Res. 2015 Apr 7. doi: 10.1038/cr.2015.43.
AP56-5sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP56-6sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP56-7sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP56-8sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP54-3sgRNA for APs12 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP54-5sgRNA for APs12 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
pIK208U6 promoter::dpy-10 sgRNA with a "flipped and extended" sgRNA backbone (Caenorhabditis elegans)Worm Expression, CRISPR Katic CRISPR/Cas9 Genome Editing in Caenorhabditis elegans: Evaluation of Templates for Homology-Mediated Repair and Knock-Ins by Homology-Independent DNA Repair. G3 (Bethesda). 2015 Jun 3. pii: g3.115.019273. doi: 10.1534/g3.115.019273.
pCASCADE-gltA2gltA2 guide (Synthetic)Bacterial Expression Lynch SUPERSEDE (unpublished)
pCASCADE-udhAudhA guide (Synthetic)Bacterial Expression Lynch SUPERSEDE (unpublished)
pCASCADE-gltA2-udhAgltA2-udhA guide array (Synthetic)Bacterial Expression Lynch SUPERSEDE (unpublished)
pCASCADEcontrol guideRNA (Synthetic)Bacterial Expression Lynch SUPERSEDE (unpublished)
pCASCADE-zwfzwf guide (Synthetic)Bacterial Expression Lynch SUPERSEDE (unpublished)
APq5271sgRNA for APa4-2Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
APq5210sgRNA for APa4-2Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP303-3sgRNA for APs1Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP303-4sgRNA for APs1Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP332-2sgRNA for APs4Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP332-3sgRNA for APs4Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP332-4sgRNA for APs4Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP324-2sgRNA for APs6Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP324-3sgRNA for APs6Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP324-4sgRNA for APs6Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP334-2sgRNA for APs5Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP334-5sgRNA for APs5Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP334-6sgRNA for APs5Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
APCSD 53sgRNA for CSD 53Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
APCSD 54sgRNA for CSD 54Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
pJZC42sgRNA + 1XPP7, PCP-VP64 IRES mCherryMammalian Expression Lim Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC43sgRNA + 2XPP7, PCP-VP64 IRES mCherryMammalian Expression Lim Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pX330.iGFP1iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.iGFP2iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.iGFP3iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.iGFP5iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.LoxPOLSL-TomatoMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.LoxPLoxP sgRNAMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.Pten.aPten deletion (Mus musculus)Mammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.Pten.bPten deletion (Mus musculus)Mammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
Lenti-sgLkb1/CresgLkb1 (Mus musculus)Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR Winslow Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15.
Lenti-sgNT/CresgNT (Mus musculus)Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR Winslow Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15.
pCAS9-mCherry-TUBBgRNA TUBB Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.
pCAS9-mCherry-ACTG1gRNA ACTG1 (Homo sapiens) Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.
pCAS9-mCherry-HIST1H4CgRNA HIST1H4C (Homo sapiens) Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.
Oct4-Cr1gRNA for Crispr targeting the OCT4 stop codon (Homo sapiens)Mammalian Expression Huangfu A CRISPR/Cas-Mediated Selection-free Knockin Strategy in Human Embryonic Stem Cells. Stem Cell Reports. 2015 May 28. pii: S2213-6711(15)00128-9. doi: 10.1016/j.stemcr.2015.04.016.
Lenti-sgNeo/CresgNeo (Mus musculus)Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR Winslow Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15.
pKLV2-U6gRNA5(gBFP)-PGKGFP2ABFP-WU6gRNA cassette, PGKGFP2ABFP cassette, WPRE (Homo sapiens), Guide RNA targeting modified BFPLentiviral, CRISPR Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079.
pKLV2-U6gRNA5(gBFP)-PGKmCherry2ABFP-WU6gRNA cassette, PGKmCherryABFP cassette, WPRE (Homo sapiens), Guide RNA targeting modified BFP (Synthetic)Lentiviral, CRISPR Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079.
p426-SNR52p-gRNA.csr-1.Y-SUP4tgRNA for csr-1 locus (Other)Yeast Expression, CRISPR ; N. crassa, Fungi Hong Efficient gene editing in Neurospora crassa with CRISPR technology Fungal Biology and Biotechnology 2015, 2:4
pICSL11057Promote:TaU6+sgRNA HvPM19_1 (Other)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.
pICSL11058Promoter_TaU6 + sgRNA_HvPM19_3 (Other)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.
pICSL11061Promoter_AtU6-26 + sgRNA_BolC.GA4a-1 (Arabidopsis thaliana)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.
pICSL11062Promoter_AtU6-26 + sgRNA_BolC.GA4a-2 (Arabidopsis thaliana)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA3xgRNA;PTENA, p53B,SMAD4A (Synthetic), FlPO (Synthetic)Mammalian Expression, AAV ; Flp/Frt Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)
px330_PTEN exon 5 gRNAPTEN exon 5 gRNA (Synthetic)Mammalian Expression Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)
px330_P53 exon 8 gRNAP53 exon 8 gRNA (Synthetic)Mammalian Expression Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)
px330_SMAD exon 2 gRNASMAD exon 2 gRNA (Synthetic)Mammalian Expression Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)
px330_P53 exon 7 gRNAP53 exon 7 gRNA (Synthetic)Mammalian Expression Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)
px330_SMAD exon 9 gRNASMAD exon 9 gRNA (Synthetic)Mammalian Expression Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 (Synthetic), FlpO recombinase (Synthetic)Mammalian Expression, CRISPR Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 (Synthetic), FlpO recombinase (Synthetic)Mammalian Expression, CRISPR Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 (Synthetic), FlpO (Synthetic)Mammalian Expression, CRISPR Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)
pU6_(GLuc)_sgRNAGluc sgRNA (Synthetic)Mammalian Expression, CRISPR Rinn Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1.
pCMV/3' Box_(GLuc)_INT INT construct_bearing three PP7 Stem-loops (Synthetic)Mammalian Expression, CRISPR, Synthetic Biology Rinn Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1.
PAX6 sgRNA2sgRNA targeting PAX6 (Homo sapiens)Mammalian Expression, CRISPR Zhang Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001.
PAX6 sgRNA7sgRNA targeting PAX6 (Homo sapiens)Mammalian Expression, CRISPR Zhang Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001.
pX330-sgRNA_Dicer_1sgRNA mouse Dicer1 (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb.
pX330-sgRNA_Dicer_2sgRNA mouse Dicer1 (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb.
pX330-sgRNA_Dicer_3sgRNA mouse Dicer1 (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb.
pMM704dCas9, LacI, sgRNA Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst. 2015 Jul 29;1(1):62-71. doi: 10.1016/j.cels.2015.06.001.
pMM705dCas9, LacI, sgRNA Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst. 2015 Jul 29;1(1):62-71. doi: 10.1016/j.cels.2015.06.001.
pMM710dCas9, LacI, sgRNA Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst. 2015 Jul 29;1(1):62-71. doi: 10.1016/j.cels.2015.06.001.
pMM725dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst. 2015 Jul 29;1(1):62-71. doi: 10.1016/j.cels.2015.06.001.
pMM731dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst. 2015 Jul 29;1(1):62-71. doi: 10.1016/j.cels.2015.06.001.
pMM732dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst. 2015 Jul 29;1(1):62-71. doi: 10.1016/j.cels.2015.06.001.
pMM733dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst. 2015 Jul 29;1(1):62-71. doi: 10.1016/j.cels.2015.06.001.
pMM750dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst. 2015 Jul 29;1(1):62-71. doi: 10.1016/j.cels.2015.06.001.
pMM763dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst. 2015 Jul 29;1(1):62-71. doi: 10.1016/j.cels.2015.06.001.
pMM764dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst. 2015 Jul 29;1(1):62-71. doi: 10.1016/j.cels.2015.06.001.
pLKO1-puro-U6-sgRNA-TS2TS2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-TS3TS3 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-TS4TS4 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-LRTM2LRTM2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-KANK3KANK3 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-TGM2TGM2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-PLXNB2PLXNB2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
GG-EBNA-OCT45 concatenated gRNA transcriptional cassettes targeting OCT4CRISPR Otonkoski Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation. Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001.
HPRT2b-pGEMHPRT gRNA2 (Homo sapiens)Mammalian Expression Yan Enriching CRISPR-Cas9 targeted cells by co-targeting the HPRT gene. Nucleic Acids Res. 2015 Jun 29. pii: gkv675.
pZDonor-U6-myogenin stop codon gRNAMyogenin C terminus-targeting guide RNA (Mus musculus)CRISPR Gersbach TMG reporters (unpublished)
pX330-mitfmitf-sgRNA (Other), SpCas9 (Synthetic)Mammalian Expression Zhao Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs. Sci Rep. 2015 Aug 21;5:13348. doi: 10.1038/srep13348.
CRISPRmTmG2gRNA that targets near LoxP sites Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21.
pTC217Nuclease (Cas9/sgRNA) + Donor + GVR (Other)Plant Expression, CRISPR Voytas High-frequency, precise modification of the tomato genome. Genome Biol. 2015 Nov 6;16(1):232. doi: 10.1186/s13059-015-0796-9.
pTC223Nuclease (Cas9/sgRNA) + Donor + GVR (Other)Plant Expression, CRISPR Voytas High-frequency, precise modification of the tomato genome. Genome Biol. 2015 Nov 6;16(1):232. doi: 10.1186/s13059-015-0796-9.
AP568-2sgRNA for dpy‐10Worm Expression, CRISPR Seydoux High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17.
AP568-3sgRNA for dpy‐10Worm Expression, CRISPR Seydoux High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17.
lentiCRISPR - C16orf80 sgRNA 2sgRNA against C16orf80Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - C16orf80 sgRNA 1sgRNA against C16orf80Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - C3orf17 sgRNA 1sgRNA against C3orf17Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - C3orf17 sgRNA 2sgRNA against C3orf17Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - C9orf114 sgRNA 2sgRNA against C9orf114Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - C9orf114 sgRNA 1 sgRNA against C9orf114Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - DDX3Y sgRNA 1sgRNA against DDX3YMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - DDX3Y sgRNA 2sgRNA against DDX3YMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - Amplicon, BCR/ABL sgRNA 2sgRNA against BCR/ABLamplicon found in CML-derived K562 cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - Amplicon, BCR/ABL sgRNA 1sgRNA against BCR/ABLamplicon found in CML-derived K562 cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - Amplicon, JAK2 sgRNA 2sgRNA against JAK2 amplicon found in AML-derived HEL cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - AAVS1 sgRNAsgRNA against AAVS1Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - CTRL sgRNAnon-targeting sgRNAMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - Amplicon, JAK2 sgRNA 1 sgRNA against JAK2 amplicon found in AML-derived HEL cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
pHEE2E-TRIsgRNA targeting TRY and CPC genes (Synthetic), sgRNA targeting ETC2 gene (Synthetic), zCas9 (Other)Plant Expression, CRISPR ; Plant binary vector Chen Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0.
pRB1081dpy-10 gRNA (Synthetic)Worm Expression, CRISPR Fire Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans. Genetics. 2015 Dec 17. pii: genetics.115.185041.
sgPal1 (p2Tol-U6-sgPal1-HygR)sgPal1 Sherwood Cloning-free CRISPR. Stem Cell Reports. 2015 Oct 27. pii: S2213-6711(15)00284-2. doi: 10.1016/j.stemcr.2015.09.022.
sgPal7 (p2Tol-U6-sgPal7-HygR)sgPal7 Sherwood Cloning-free CRISPR. Stem Cell Reports. 2015 Oct 27. pii: S2213-6711(15)00284-2. doi: 10.1016/j.stemcr.2015.09.022.
pRB1084dpy-10 gRNA (Synthetic)Worm Expression, CRISPR Fire Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans. Genetics. 2015 Dec 17. pii: genetics.115.185041.
SS9_RNASS9 gRNA (Other)Bacterial Expression, CRISPR Gill Rapid and Efficient One-Step Metabolic Pathway Integration in E. coli. ACS Synth Biol. 2016 Apr 22.
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8BACH2-sgRNA8 (Homo sapiens)Mammalian Expression, CRISPR Zoldoš Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Res. 2016 Mar 11. pii: gkw159.
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8 (ANV)BACH2-sgRNA8 (Homo sapiens)Mammalian Expression, CRISPR Zoldoš Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Res. 2016 Mar 11. pii: gkw159.
pdCas9-DNMT3A-PuroR_hNTNon-targeting sgRNA human (Homo sapiens)Mammalian Expression, CRISPR Zoldoš Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Res. 2016 Mar 11. pii: gkw159.
PX458_ATF4_1ATF4 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_ATF4_2ATF4 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_HHEX_1HHEX (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_HHEX_2HHEX (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_PBX2_1PBX2 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_PBX2_2PBX2 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_ZNF146_1ZNF146 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_ZNF146_2ZNF146 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_ZNF3_1ZNF3 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_ZNF3_2ZNF3 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_DNMT3BDNMT3B (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_ZNF219_1ZNF219 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_ZNF219_2ZNF219 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_SSRP1_1SSRP1 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_SSRP1_2SSRP1 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_TGIF2_1TGIF2 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
PX458_TGIF2_2TGIF2 (Homo sapiens)CRISPR Mendenhall Mendenhall CRISPR tagging plasmids (unpublished)
pDECKO_GFPgRNAs toward GFP (Synthetic)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_Malat1_AgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_Malat1_BgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_Malat1_CgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_Malat1_DgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_Malat1_EgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_TFRC_BgRNAs toward TFRC (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_TFRC_C (with mCherry)gRNAs toward TFRC (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_UCA1gRNAs toward UCA1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
AAVS1 T2 CRIPR in pX330Cas9 and gRNA for targeting the AAVS1 locus in human cells (Homo sapiens)Mammalian Expression, CRISPR Kanemaki Rapid Protein Depletion in Human Cells by Auxin-Inducible Degron Tagging with Short Homology Donors. Cell Rep. 2016 Apr 5;15(1):210-8. doi: 10.1016/j.celrep.2016.03.001. Epub 2016 Mar 24.
pT7-gRNA_zebrafish_mmp21zebrafish mmp21 (Danio rerio)CRISPR Katsanis A human laterality disorder caused by a homozygous deleterious mutation in MMP21. J Med Genet. 2015 Dec;52(12):840-7. doi: 10.1136/jmedgenet-2015-103336. Epub 2015 Oct 1.
pMD19T-slr0230-PL31-sgRNANT1-KmRPL31-sgRNA NT1Bacterial Expression Hudson Multiple Gene Repression in Cyanobacteria Using CRISPRi. ACS Synth Biol. 2015 Dec 28.
pMD19T-slr0230-PL22-sgRNANT1-KmRPL22-sgRNA NT1Bacterial Expression Hudson Multiple Gene Repression in Cyanobacteria Using CRISPRi. ACS Synth Biol. 2015 Dec 28.
pNICKclos2.0Cas9 nickase (Other), sgRNA to xylR (Synthetic)E.coli - clostridium shuttle vector Yang CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053.
pCfB3020(gRNA X-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3041(gRNA X-3)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3042(gRNA X-4)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3043(gRNA XI-1)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3044(gRNA XI-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3045(gRNA XI-3)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3046(gRNA XI-5)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3047(gRNA XII-1)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3048(gRNA XII-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3049(gRNA XII-4)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3050(gRNA XII-5)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3051(gRNA X-3 XI-2 XII-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3052(gRNA X-4, XI-3, XII-5)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3053(gRNA X-2, XI-5, XII-4)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pdCas9-M-C4Repressor C4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-3F2Repressor C4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-3H5Repressor 3H5 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-1B6Repressor 1B6 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-4F2Repressor 4F2 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-5F5Repressor 5F5 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-1D4Repressor 1D4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-4A6Repressor 4A6 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-3A2Repressor 3A2 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-1E4Repressor 1E4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-G6Repressor G6 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pX330-sgRNA_Dgcr8_1DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Dgcr8_2DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Dgcr8_3DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Dgcr8_4DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Ago2_1AGO2 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX330-sgRNA_Ago2_2AGO2 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago2_3AGO2 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago2_4AGO2 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago1_1AGO1 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago1_2AGO1 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago1_3AGO1 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago1_4AGO1 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pNICKclos1.0Cas9 nickase (Other), sGRNA to pyrEE.coli-clostridium shuttle vector Yang CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053.
pdCASclosdCas9 (Other), sgRNA to spo0AE.coli-clostridium shuttle vector Yang CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053.
B51gRNA (Mus musculus)CRISPR Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21.
B53gRNA (Mus musculus)CRISPR Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21.
B31gRNA (Mus musculus)CRISPR Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21.
B33gRNA (Mus musculus)CRISPR Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21.
pAL-pgi_TsgRNA pgi (T)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-pgi_NTsgRNA pgi (NT) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-pck_TsgRNA pck (T) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-pck_NTsgRNA pck (NT) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-pyk_TsgRNA pyk (T) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-pyk_NTsgRNA pyk (NT) (Synthetic)Bacterial Expression, CRISPR Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-rfp_TsgRNA rfp (T) (Synthetic)Bacterial Expression, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pLCKO_LacZ_sgRNALacZ sgRNA (Other)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_PSMD1_sgRNA_1PSMD1 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_PSMD1_sgRNA_5PSMD1 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_PSMB2_sgRNA_1PSMB2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_PSMB2_sgRNA_5PSMB2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_EIF3D_sgRNA_1EIF3D sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_EIF3D_sgRNA_4EIF3D sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_Luciferase_sgRNALuciferase sgRNA (Other)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pMOD8A-iRGR-r11RGR-r11 (Synthetic)Yeast Expression, CRISPR, Synthetic Biology Klavins Robust digital logic circuits in eukaryotic cells with CRISPR/dCas9 NOR gates bioRxiv 041871
pMOD8A-RGR-r10RGR-r10 (Synthetic)Yeast Expression, CRISPR, Synthetic Biology Klavins Robust digital logic circuits in eukaryotic cells with CRISPR/dCas9 NOR gates bioRxiv 041871
pX462-hPRKAA1-gRNA_Ahuman AMPK alpha 1 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138.
pX462-hPRKAA1-gRNA_Bhuman AMPK alpha 1 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138.
pX462-hPRKAA2-gRNA_Ahuman AMPK alpha 2 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138.
pX462-hPRKAA2-gRNA_Bhuman AMPK alpha 2 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138.
pUC57-sgDedd-1Dedd (Mus musculus)Mammalian Expression, CRISPR Arck pUC57-sgDedd-1 (unpublished)
pUC57-sgDedd-2Dedd (Mus musculus)Mammalian Expression, CRISPR Arck pUC57-sgDedd-1 (unpublished)
pBluescriptSKII+ U6-sgRNA(F+E) ACTBU6 promoter driving sgRNA targeting the 3'UTR of ACTB mRNAMammalian Expression, CRISPR Yeo Programmable RNA Tracking in Live Cells with CRISPR/Cas9. Cell. 2016 Mar 16. pii: S0092-8674(16)30204-5. doi: 10.1016/j.cell.2016.02.054.
pBluescriptSKII+ U6-sgRNA(F+E) TFRCU6 promoter driving sgRNA targeting the 3'UTR of TFRC mRNAMammalian Expression, CRISPR Yeo Programmable RNA Tracking in Live Cells with CRISPR/Cas9. Cell. 2016 Mar 16. pii: S0092-8674(16)30204-5. doi: 10.1016/j.cell.2016.02.054.
pLC-EGFP-RIP1RIPK1 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.
pLC-RFP657-CASP8CASP8 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.
pLC-EGFP-RIP3RIP3 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.
pLC-BFP-FADDFADD sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.
pLC-mCherry-MLKLMLKL sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.
NFATc2-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc2-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc2-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc2-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc1-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc1-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc1-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc1-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Ikaros-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Ikaros-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Ikaros-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Ikaros-CRISPR-Nick2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Helios-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human Helios (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Helios-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Helios (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Helios-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Helios (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
pLH-sgRNA1sgRNA1 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-2XMS2sgRNA1-2XMS2 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-2XPP7sgRNA1-2XPP7 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-2XboxBsgRNA1-2XboxB (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-MS2-PP7sgRNA1-2XMS2-PP7 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-PP7-boxBsgRNA1-2XPP7-boxB (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-boxB-MS2sgRNA1-boxB-MS2 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-boxB-MS2-PP7sgRNA1-boxB-MS2-PP7 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
NLK gRNA (BRDN0001146865)NLK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NLK gRNA (BRDN0001147584)NLK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NLK gRNA (BRDN0001147680)NLK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ACVR2B gRNA (BRDN0001145393)ACVR2B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ACVR2B gRNA (BRDN0001147208)ACVR2B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ACVR2B gRNA (BRDN0001149036)ACVR2B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK10 gRNA (BRDN0001148022)STK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK10 gRNA (BRDN0001149099)STK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK10 gRNA (BRDN0001162510)STK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK10 gRNA (BRDN0001162500)STK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDGFRA gRNA (BRDN0001145116)PDGFRA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDGFRA gRNA (BRDN0001145903)PDGFRA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDGFRA gRNA (BRDN0001148373)PDGFRA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STRADB gRNA (BRDN0001146450)STRADB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STRADB gRNA (BRDN0001146838)STRADB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STRADB gRNA (BRDN0001148940)STRADB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA1 gRNA (BRDN0001145974)RPS6KA1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA1 gRNA (BRDN0001148103)RPS6KA1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA1 gRNA (BRDN0001148481)RPS6KA1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
AKT1 gRNA (BRDN0001146935)AKT1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
AKT1 gRNA (BRDN0001149266)AKT1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
AKT1 gRNA (BRDN0001149414)AKT1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BCKDK gRNA (BRDN0001147783)BCKDK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BCKDK gRNA (BRDN0001147891)BCKDK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BCKDK gRNA (BRDN0001149253)BCKDK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
INSR gRNA (BRDN0001145804)INSR (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
INSR gRNA (BRDN0001148089)INSR (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
INSR gRNA (BRDN0001149243)INSR (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K2 gRNA (BRDN0001145545)MAP3K2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K2 gRNA (BRDN0001146616)MAP3K2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K2 gRNA (BRDN0001147901)MAP3K2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MKNK1 gRNA (BRDN0001146808)MKNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MKNK1 gRNA (BRDN0001146937)MKNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MKNK1 gRNA (BRDN0001148208)MKNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKACA gRNA (BRDN0001144986)PRKACA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKACA gRNA (BRDN0001145395)PRKACA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKACA gRNA (BRDN0001145877)PRKACA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKACA gRNA (BRDN0001148333)PRKACA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DYRK4 gRNA (BRDN0001145834)DYRK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DYRK4 gRNA (BRDN0001147655)DYRK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DYRK4 gRNA (BRDN0001149224)DYRK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
VRK1 gRNA (BRDN0001147568)VRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
VRK1 gRNA (BRDN0001148483)VRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
VRK1 gRNA (BRDN0001149207)VRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
VRK1 gRNA (BRDN0001149172)VRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMKV gRNA (BRDN0001145768)CAMKV (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMKV gRNA (BRDN0001162514)CAMKV (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMKV gRNA (BRDN0001162507)CAMKV (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMKV gRNA (BRDN0001162273)CAMKV (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ETNK1 gRNA (BRDN0001147553)ETNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ETNK1 gRNA (BRDN0001148309)ETNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ETNK1 gRNA (BRDN0001148358)ETNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA6 gRNA (BRDN0001145731)RPS6KA6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA6 gRNA (BRDN0001146818)RPS6KA6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA6 gRNA (BRDN0001147018)RPS6KA6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA6 gRNA (BRDN0001147921)RPS6KA6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME1 gRNA (BRDN0001145504)NME1,NME1-NME2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME1 gRNA (BRDN0001146170)NME1,NME1-NME2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME1 gRNA (BRDN0001146284)NME1,NME1-NME2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SGK3 gRNA (BRDN0001146019)C8orf44-SGK3,SGK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SGK3 gRNA (BRDN0001146281)C8orf44-SGK3,SGK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SGK3 gRNA (BRDN0001147184)C8orf44-SGK3,SGK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PTK2 gRNA (BRDN0001145734)PTK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PTK2 gRNA (BRDN0001146703)PTK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PTK2 gRNA (BRDN0001148426)PTK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DYRK3 gRNA (BRDN0001145321)DYRK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DYRK3 gRNA (BRDN0001145918)DYRK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DYRK3 gRNA (BRDN0001149001)DYRK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
VRK3 gRNA (BRDN0001144937)VRK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
VRK3 gRNA (BRDN0001145580)VRK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
VRK3 gRNA (BRDN0001147251)VRK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
VRK3 gRNA (BRDN0001148188)VRK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCQ gRNA (BRDN0001144886)PRKCQ (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCQ gRNA (BRDN0001145693)PRKCQ (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCQ gRNA (BRDN0001147386)PRKCQ (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FLT1 gRNA (BRDN0001145335)FLT1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FLT1 gRNA (BRDN0001145564)FLT1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FLT1 gRNA (BRDN0001146782)FLT1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FLT1 gRNA (BRDN0001147168)FLT1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK11 gRNA (BRDN0001144720)NEK11 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK11 gRNA (BRDN0001145274)NEK11 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK11 gRNA (BRDN0001146419)NEK11 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK11 gRNA (BRDN0001147265)NEK11 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TBCK gRNA (BRDN0001147900)TBCK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TBCK gRNA (BRDN0001148062)TBCK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TBCK gRNA (BRDN0001149038)TBCK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TBCK gRNA (BRDN0001149188)TBCK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYO3B gRNA (BRDN0001145051)MYO3B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYO3B gRNA (BRDN0001145445)MYO3B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYO3B gRNA (BRDN0001145615)MYO3B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYO3B gRNA (BRDN0001147808)MYO3B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PBK gRNA (BRDN0001145450)PBK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PBK gRNA (BRDN0001145489)PBK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PBK gRNA (BRDN0001147308)PBK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NUAK1 gRNA (BRDN0001145557)NUAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NUAK1 gRNA (BRDN0001147733)NUAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NUAK1 gRNA (BRDN0001162598)NUAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NUAK1 gRNA (BRDN0001162525)NUAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TTK gRNA (BRDN0001145152)TTK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TTK gRNA (BRDN0001146504)TTK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TTK gRNA (BRDN0001147779)TTK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNK2 gRNA (BRDN0001148153)TNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNK2 gRNA (BRDN0001148514)TNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNK2 gRNA (BRDN0001149049)TNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNK2 gRNA (BRDN0001149191)TNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CSNK2A2 gRNA (BRDN0001144724)CSNK2A2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CSNK2A2 gRNA (BRDN0001147190)CSNK2A2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CSNK2A2 gRNA (BRDN0001148502)CSNK2A2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA1 gRNA (BRDN0001145712)EPHA1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA1 gRNA (BRDN0001147142)EPHA1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA1 gRNA (BRDN0001148678)EPHA1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3R4 gRNA (BRDN0001145205)PIK3R4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3R4 gRNA (BRDN0001145724)PIK3R4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3R4 gRNA (BRDN0001148885)PIK3R4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3R4 gRNA (BRDN0001148908)PIK3R4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ZAK gRNA (BRDN0001145178)ZAK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ZAK gRNA (BRDN0001146540)ZAK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ZAK gRNA (BRDN0001146874)ZAK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SRPK2 gRNA (BRDN0001145577)SRPK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SRPK2 gRNA (BRDN0001145583)SRPK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SRPK2 gRNA (BRDN0001146940)SRPK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRIB2 gRNA (BRDN0001144754)TRIB2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRIB2 gRNA (BRDN0001148141)TRIB2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRIB2 gRNA (BRDN0001148332)TRIB2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL3 gRNA (BRDN0001146569)CDKL3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL3 gRNA (BRDN0001148232)CDKL3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL3 gRNA (BRDN0001148623)CDKL3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DMPK gRNA (BRDN0001145527)DMPK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DMPK gRNA (BRDN0001145673)DMPK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DMPK gRNA (BRDN0001146276)DMPK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DMPK gRNA (BRDN0001147274)DMPK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KB1 gRNA (BRDN0001145729)RPS6KB1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KB1 gRNA (BRDN0001145927)RPS6KB1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KB1 gRNA (BRDN0001148368)RPS6KB1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TLK2 gRNA (BRDN0001146448)TLK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TLK2 gRNA (BRDN0001147069)TLK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TLK2 gRNA (BRDN0001147939)TLK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK15 gRNA (BRDN0001145787)MAPK15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK15 gRNA (BRDN0001148491)MAPK15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK15 gRNA (BRDN0001162376)MAPK15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK15 gRNA (BRDN0001162374)MAPK15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK1 gRNA (BRDN0001146391)WNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK1 gRNA (BRDN0001147437)WNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK1 gRNA (BRDN0001148217)WNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK40 gRNA (BRDN0001147563)STK40 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK40 gRNA (BRDN0001147746)STK40 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK40 gRNA (BRDN0001149285)STK40 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK40 gRNA (BRDN0001149509)STK40 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FLT4 gRNA (BRDN0001147158)FLT4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FLT4 gRNA (BRDN0001147213)FLT4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FLT4 gRNA (BRDN0001149037)FLT4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK10 gRNA (BRDN0001146401)NEK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK10 gRNA (BRDN0001149193)NEK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK10 gRNA (BRDN0001162522)NEK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK10 gRNA (BRDN0001162335)NEK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EIF2AK2 gRNA (BRDN0001146342)EIF2AK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EIF2AK2 gRNA (BRDN0001148577)EIF2AK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EIF2AK2 gRNA (BRDN0001148668)EIF2AK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HSPB8 gRNA (BRDN0001145453)HSPB8 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HSPB8 gRNA (BRDN0001146985)HSPB8 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HSPB8 gRNA (BRDN0001147486)HSPB8 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK6 gRNA (BRDN0001145692)CDK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK6 gRNA (BRDN0001146904)CDK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK6 gRNA (BRDN0001147855)CDK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK6 gRNA (BRDN0001148604)CDK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TSSK2 gRNA (BRDN0001144840)TSSK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TSSK2 gRNA (BRDN0001148461)TSSK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TSSK2 gRNA (BRDN0001148488)TSSK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SRC gRNA (BRDN0001145402)SRC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SRC gRNA (BRDN0001146185)SRC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SRC gRNA (BRDN0001149457)SRC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BMX gRNA (BRDN0001146364)BMX (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BMX gRNA (BRDN0001146561)BMX (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BMX gRNA (BRDN0001147055)BMX (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK4 gRNA (BRDN0001147338)WNK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK4 gRNA (BRDN0001147390)WNK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK4 gRNA (BRDN0001148891)WNK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK4 gRNA (BRDN0001148888)WNK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ARAF gRNA (BRDN0001147899)ARAF (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ARAF gRNA (BRDN0001148242)ARAF (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ARAF gRNA (BRDN0001148605)ARAF (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK9 gRNA (BRDN0001146898)NEK9 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IRAK4 gRNA (BRDN0001146161)IRAK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IRAK4 gRNA (BRDN0001147550)IRAK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IRAK4 gRNA (BRDN0001149331)IRAK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MELK gRNA (BRDN0001144817)MELK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MELK gRNA (BRDN0001145853)MELK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MELK gRNA (BRDN0001146713)MELK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK2 gRNA (BRDN0001148439)WNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK2 gRNA (BRDN0001162416)WNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK2 gRNA (BRDN0001162408)WNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WNK2 gRNA (BRDN0001162262)WNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKAB1 gRNA (BRDN0001146320)PRKAB1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKAB1 gRNA (BRDN0001146367)PRKAB1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKAB1 gRNA (BRDN0001162435)PRKAB1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKAB1 gRNA (BRDN0001162244)PRKAB1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAK3 gRNA (BRDN0001148041)PAK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAK3 gRNA (BRDN0001148181)PAK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAK3 gRNA (BRDN0001148485)PAK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADRBK1 gRNA (BRDN0001144871)ADRBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADRBK1 gRNA (BRDN0001145957)ADRBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADRBK1 gRNA (BRDN0001147663)ADRBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADRBK1 gRNA (BRDN0001147919)ADRBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDK2 gRNA (BRDN0001145761)PDK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDK2 gRNA (BRDN0001146093)PDK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDK2 gRNA (BRDN0001148391)PDK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EGFR gRNA (BRDN0001146570)EGFR (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EGFR gRNA (BRDN0001148919)EGFR (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EGFR gRNA (BRDN0001149231)EGFR (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EGFR gRNA (BRDN0001149464)EGFR (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K7 gRNA (BRDN0001145981)MAP3K7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K7 gRNA (BRDN0001148020)MAP3K7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K7 gRNA (BRDN0001148226)MAP3K7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STYK1 gRNA (BRDN0001145785)STYK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STYK1 gRNA (BRDN0001146810)STYK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STYK1 gRNA (BRDN0001146987)STYK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DCLK2 gRNA (BRDN0001145364)DCLK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DCLK2 gRNA (BRDN0001162232)DCLK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DCLK2 gRNA (BRDN0001162228)DCLK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DCLK2 gRNA (BRDN0001162199)DCLK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK6 gRNA (BRDN0001145803)GRK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK6 gRNA (BRDN0001146204)GRK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK6 gRNA (BRDN0001146643)GRK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK6 gRNA (BRDN0001147105)GRK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK20 gRNA (BRDN0001144911)CDK20 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK20 gRNA (BRDN0001146337)CDK20 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK20 gRNA (BRDN0001146285)CDK20 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK20 gRNA (BRDN0001147842)CDK20 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP4K5 gRNA (BRDN0001145246)MAP4K5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP4K5 gRNA (BRDN0001149200)MAP4K5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP4K5 gRNA (BRDN0001149337)MAP4K5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAK7 gRNA (BRDN0001146752)PAK7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAK7 gRNA (BRDN0001147115)PAK7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAK7 gRNA (BRDN0001149524)PAK7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LRRK1 gRNA (BRDN0001148276)LRRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LRRK1 gRNA (BRDN0001148931)LRRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LRRK1 gRNA (BRDN0001149233)LRRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGR gRNA (BRDN0001146726)FGR (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGR gRNA (BRDN0001147671)FGR (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGR gRNA (BRDN0001147903)FGR (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TEK gRNA (BRDN0001146784)TEK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TEK gRNA (BRDN0001148630)TEK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TEK gRNA (BRDN0001148973)TEK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TEK gRNA (BRDN0001149392)TEK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
JAK2 gRNA (BRDN0001146541)JAK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
JAK2 gRNA (BRDN0001147052)JAK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
JAK2 gRNA (BRDN0001149125)JAK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGFR3 gRNA (BRDN0001146639)FGFR3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGFR3 gRNA (BRDN0001147930)FGFR3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGFR3 gRNA (BRDN0001148456)FGFR3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA2 gRNA (BRDN0001147334)RPS6KA2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA2 gRNA (BRDN0001148104)RPS6KA2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA2 gRNA (BRDN0001148851)RPS6KA2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA2 gRNA (BRDN0001149230)RPS6KA2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK1 gRNA (BRDN0001145044)ULK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK1 gRNA (BRDN0001145850)ULK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK1 gRNA (BRDN0001147908)ULK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3C2G gRNA (BRDN0001148187)PIK3C2G (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3C2G gRNA (BRDN0001148335)PIK3C2G (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3C2G gRNA (BRDN0001149539)PIK3C2G (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADK gRNA (BRDN0001146463)ADK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADK gRNA (BRDN0001146410)ADK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADK gRNA (BRDN0001146622)ADK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADK gRNA (BRDN0001147557)ADK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDC42BPA gRNA (BRDN0001145566)CDC42BPA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDC42BPA gRNA (BRDN0001146626)CDC42BPA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDC42BPA gRNA (BRDN0001147767)CDC42BPA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BLK gRNA (BRDN0001146701)BLK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BLK gRNA (BRDN0001147641)BLK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BLK gRNA (BRDN0001149130)BLK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BLK gRNA (BRDN0001149400)BLK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMK2A gRNA (BRDN0001149371)CAMK2A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SIK3 gRNA (BRDN0001144776)SIK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SIK3 gRNA (BRDN0001148297)SIK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SIK3 gRNA (BRDN0001148836)SIK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SIK3 gRNA (BRDN0001149197)SIK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3R5 gRNA (BRDN0001145982)PIK3R5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3R5 gRNA (BRDN0001146332)PIK3R5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3R5 gRNA (BRDN0001146461)PIK3R5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CALM1 gRNA (BRDN0001145447)CALM1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CALM1 gRNA (BRDN0001145487)CALM1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CALM1 gRNA (BRDN0001146464)CALM1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CALM1 gRNA (BRDN0001148506)CALM1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
UCK2 gRNA (BRDN0001145127)UCK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
UCK2 gRNA (BRDN0001145769)UCK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
UCK2 gRNA (BRDN0001146352)UCK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
UCK2 gRNA (BRDN0001146876)UCK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SMG1 gRNA (BRDN0001144779)SMG1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SMG1 gRNA (BRDN0001146980)SMG1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SMG1 gRNA (BRDN0001149395)SMG1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SMG1 gRNA (BRDN0001149508)SMG1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GK5 gRNA (BRDN0001146859)GK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GK5 gRNA (BRDN0001148146)GK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GK5 gRNA (BRDN0001149330)GK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MST1 gRNA (BRDN0001146525)MST1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MST1 gRNA (BRDN0001147042)MST1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MST1 gRNA (BRDN0001148968)MST1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HK3 gRNA (BRDN0001146645)HK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HK3 gRNA (BRDN0001148398)HK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HK3 gRNA (BRDN0001149028)HK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HK3 gRNA (BRDN0001149156)HK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TKFC gRNA (BRDN0001144729)TKFC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TKFC gRNA (BRDN0001146826)TKFC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TKFC gRNA (BRDN0001148963)TKFC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TKFC gRNA (BRDN0001149092)TKFC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK5 gRNA (BRDN0001144735)PLK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK5 gRNA (BRDN0001145831)PLK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK5 gRNA (BRDN0001146558)PLK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK5 gRNA (BRDN0001147846)PLK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SGK223 gRNA (BRDN0001146707)SGK223 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SGK223 gRNA (BRDN0001147337)SGK223 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SGK223 gRNA (BRDN0001147947)SGK223 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GSAP gRNA (BRDN0001146551)GSAP (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GSAP gRNA (BRDN0001146681)GSAP (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GSAP gRNA (BRDN0001148675)GSAP (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK1 gRNA (BRDN0001145304)SBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK1 gRNA (BRDN0001146823)SBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK1 gRNA (BRDN0001148216)SBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK1 gRNA (BRDN0001148223)SBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TTBK1 gRNA (BRDN0001145252)TTBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TTBK1 gRNA (BRDN0001146632)TTBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TTBK1 gRNA (BRDN0001148007)TTBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CMPK2 gRNA (BRDN0001144952)CMPK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CMPK2 gRNA (BRDN0001145007)CMPK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CMPK2 gRNA (BRDN0001147027)CMPK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKDCC gRNA (BRDN0001144772)PKDCC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKDCC gRNA (BRDN0001144824)PKDCC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKDCC gRNA (BRDN0001145657)PKDCC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKDCC gRNA (BRDN0001148026)PKDCC (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STKLD1 gRNA (BRDN0001147552)STKLD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STKLD1 gRNA (BRDN0001148566)STKLD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STKLD1 gRNA (BRDN0001162456)STKLD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYLK4 gRNA (BRDN0001145660)MYLK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYLK4 gRNA (BRDN0001146621)MYLK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYLK4 gRNA (BRDN0001146724)MYLK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
COASY gRNA (BRDN0001145497)COASY (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
COASY gRNA (BRDN0001145628)COASY (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
COASY gRNA (BRDN0001147007)COASY (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
COASY gRNA (BRDN0001147178)COASY (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIP5KL1 gRNA (BRDN0001145139)PIP5KL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIP5KL1 gRNA (BRDN0001146428)PIP5KL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIP5KL1 gRNA (BRDN0001148279)PIP5KL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CD2 gRNA (BRDN0001145097)CD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CD2 gRNA (BRDN0001146027)CD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CD2 gRNA (BRDN0001146864)CD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CD2 gRNA (BRDN0001148522)CD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NMRK1 gRNA (BRDN0001144748)NMRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NMRK1 gRNA (BRDN0001145652)NMRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NMRK1 gRNA (BRDN0001148142)NMRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MPP7 gRNA (BRDN0001145242)MPP7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MPP7 gRNA (BRDN0001147517)MPP7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MPP7 gRNA (BRDN0001149493)MPP7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SNX16 gRNA (BRDN0001146480)SNX16 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SNX16 gRNA (BRDN0001147293)SNX16 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SNX16 gRNA (BRDN0001148051)SNX16 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPS1L1 gRNA (BRDN0001145013)PRPS1L1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPS1L1 gRNA (BRDN0001146253)PRPS1L1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPS1L1 gRNA (BRDN0001146979)PRPS1L1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPS1L1 gRNA (BRDN0001147147)PRPS1L1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DGKK gRNA (BRDN0001144811)DGKK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DGKK gRNA (BRDN0001145466)DGKK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DGKK gRNA (BRDN0001146124)DGKK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERN2 gRNA (BRDN0001145316)ERN2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERN2 gRNA (BRDN0001147211)ERN2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERN2 gRNA (BRDN0001162553)ERN2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERN2 gRNA (BRDN0001162277)ERN2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNIK gRNA (BRDN0001146045)TNIK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNIK gRNA (BRDN0001146101)TNIK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNIK gRNA (BRDN0001149026)TNIK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNIK gRNA (BRDN0001149184)TNIK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PEAK1 gRNA (BRDN0001145890)PEAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PEAK1 gRNA (BRDN0001147244)PEAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PEAK1 gRNA (BRDN0001147666)PEAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MEX3B gRNA (BRDN0001147189)MEX3B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MEX3B gRNA (BRDN0001147925)MEX3B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MEX3B gRNA (BRDN0001148319)MEX3B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ATMIN gRNA (BRDN0001145377)ATMIN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ATMIN gRNA (BRDN0001147857)ATMIN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ATMIN gRNA (BRDN0001148346)ATMIN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CIB4 gRNA (BRDN0001147449)CIB4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CIB4 gRNA (BRDN0001149378)CIB4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IDNK gRNA (BRDN0001146514)IDNK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IDNK gRNA (BRDN0001147773)IDNK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IDNK gRNA (BRDN0001148428)IDNK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIM3 gRNA (BRDN0001145296)PIM3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIM3 gRNA (BRDN0001145891)PIM3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIM3 gRNA (BRDN0001148886)PIM3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIM3 gRNA (BRDN0001149344)PIM3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DCAKD gRNA (BRDN0001144969)DCAKD (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DCAKD gRNA (BRDN0001148499)DCAKD (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DCAKD gRNA (BRDN0001148979)DCAKD (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EIF2AK4 gRNA (BRDN0001145948)EIF2AK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EIF2AK4 gRNA (BRDN0001146469)EIF2AK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EIF2AK4 gRNA (BRDN0001147521)EIF2AK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CKMT1A gRNA (BRDN0001145999)CKMT1A,CKMT1B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CKMT1A gRNA (BRDN0001149136)CKMT1A,CKMT1B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CKMT1A gRNA (BRDN0001149109)CKMT1A,CKMT1B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK2 gRNA (BRDN0001146871)SBK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK2 gRNA (BRDN0001147500)SBK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK2 gRNA (BRDN0001162195)SBK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK2 gRNA (BRDN0001162192)SBK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME1-NME2 gRNA (BRDN0001145211)NME1,NME1-NME2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME1-NME2 gRNA (BRDN0001147480)NME1,NME1-NME2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME1-NME2 gRNA (BRDN0001162403)NME1,NME1-NME2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME1-NME2 gRNA (BRDN0001162367)NME1,NME1-NME2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK11A gRNA (BRDN0001145793)CDK11A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK11A gRNA (BRDN0001146824)CDK11A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK11A gRNA (BRDN0001147032)CDK11A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK11A gRNA (BRDN0001147530)CDK11A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MORN2 gRNA (BRDN0001145801)MORN2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MORN2 gRNA (BRDN0001146420)MORN2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MORN2 gRNA (BRDN0001149432)MORN2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WEE2 gRNA (BRDN0001146772)WEE2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WEE2 gRNA (BRDN0001147038)WEE2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
WEE2 gRNA (BRDN0001148111)WEE2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK3 gRNA (BRDN0001146759)SBK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK3 gRNA (BRDN0001147686)SBK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SBK3 gRNA (BRDN0001148159)SBK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FPGT-TNNI3K gRNA (BRDN0001145543)FPGT-TNNI3K,TNNI3K (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FPGT-TNNI3K gRNA (BRDN0001147862)FPGT-TNNI3K,TNNI3K (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FPGT-TNNI3K gRNA (BRDN0001147836)FPGT-TNNI3K,TNNI3K (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FPGT-TNNI3K gRNA (BRDN0001148036)FPGT-TNNI3K,TNNI3K (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
C8orf44-SGK3 gRNA (BRDN0001146567)C8orf44-SGK3,SGK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
C8orf44-SGK3 gRNA (BRDN0001147093)C8orf44-SGK3,SGK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
C8orf44-SGK3 gRNA (BRDN0001148559)C8orf44-SGK3,SGK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ILK gRNA (BRDN0001147357)ILK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ILK gRNA (BRDN0001146314)ILK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ILK gRNA (BRDN0001144869)ILK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK11 gRNA (BRDN0001146880)STK11 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK11 gRNA (BRDN0001146194)STK11 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK11 gRNA (BRDN0001147319)STK11 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK12 gRNA (BRDN0001147156)CDK12 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK12 gRNA (BRDN0001147294)CDK12 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK12 gRNA (BRDN0001145847)CDK12 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BUB1B gRNA (BRDN0001148077)BUB1B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BUB1B gRNA (BRDN0001146079)BUB1B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BUB1B gRNA (BRDN0001147884)BUB1B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K8 gRNA (BRDN0001146430)MAP3K8 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K8 gRNA (BRDN0001148662)MAP3K8 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K8 gRNA (BRDN0001146835)MAP3K8 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCA gRNA (BRDN0001148197)PRKCA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCA gRNA (BRDN0001149352)PRKCA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCA gRNA (BRDN0001145588)PRKCA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BMP2K gRNA (BRDN0001145305)BMP2K (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BMP2K gRNA (BRDN0001146223)BMP2K (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BMP2K gRNA (BRDN0001146802)BMP2K (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MOS gRNA (BRDN0001147046)MOS (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MOS gRNA (BRDN0001146861)MOS (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MOS gRNA (BRDN0001146393)MOS (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK16 gRNA (BRDN0001146155)STK16 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK16 gRNA (BRDN0001146199)STK16 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK16 gRNA (BRDN0001145107)STK16 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MOK gRNA (BRDN0001145525)MOK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MOK gRNA (BRDN0001145476)MOK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MOK gRNA (BRDN0001148493)MOK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HUNK gRNA (BRDN0001146355)HUNK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HUNK gRNA (BRDN0001148239)HUNK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HUNK gRNA (BRDN0001145500)HUNK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA3 gRNA (BRDN0001144943)RPS6KA3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA3 gRNA (BRDN0001148452)RPS6KA3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KA3 gRNA (BRDN0001147852)RPS6KA3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHB3 gRNA (BRDN0001146280)EPHB3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHB3 gRNA (BRDN0001145322)EPHB3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHB3 gRNA (BRDN0001147101)EPHB3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYLK3 gRNA (BRDN0001149300)MYLK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYLK3 gRNA (BRDN0001146129)MYLK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYLK3 gRNA (BRDN0001148087)MYLK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKD3 gRNA (BRDN0001146689)PRKD3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKD3 gRNA (BRDN0001146046)PRKD3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKD3 gRNA (BRDN0001146945)PRKD3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCB gRNA (BRDN0001148507)PRKCB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCB gRNA (BRDN0001144990)PRKCB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCB gRNA (BRDN0001145137)PRKCB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK25 gRNA (BRDN0001149116)STK25 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK25 gRNA (BRDN0001148478)STK25 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK25 gRNA (BRDN0001146374)STK25 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKACB gRNA (BRDN0001145037)PRKACB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKACB gRNA (BRDN0001147109)PRKACB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKACB gRNA (BRDN0001148118)PRKACB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NTRK1 gRNA (BRDN0001147322)NTRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NTRK1 gRNA (BRDN0001145717)NTRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NTRK1 gRNA (BRDN0001148112)NTRK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK3 gRNA (BRDN0001149014)MAPK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK3 gRNA (BRDN0001147876)MAPK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK3 gRNA (BRDN0001147667)MAPK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RIPK4 gRNA (BRDN0001147121)RIPK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RIPK4 gRNA (BRDN0001144783)RIPK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RIPK4 gRNA (BRDN0001146610)RIPK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LIMK2 gRNA (BRDN0001148526)LIMK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LIMK2 gRNA (BRDN0001147235)LIMK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LIMK2 gRNA (BRDN0001148972)LIMK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK3 gRNA (BRDN0001147084)STK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK3 gRNA (BRDN0001145644)STK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK3 gRNA (BRDN0001145514)STK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KC1 gRNA (BRDN0001147352)RPS6KC1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KC1 gRNA (BRDN0001148621)RPS6KC1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KC1 gRNA (BRDN0001145776)RPS6KC1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK10 gRNA (BRDN0001148192)MAPK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK10 gRNA (BRDN0001146535)MAPK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK10 gRNA (BRDN0001148098)MAPK10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMK1G gRNA (BRDN0001148530)CAMK1G (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMK1G gRNA (BRDN0001147776)CAMK1G (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMK1G gRNA (BRDN0001146460)CAMK1G (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MASTL gRNA (BRDN0001148082)MASTL (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MASTL gRNA (BRDN0001149040)MASTL (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MASTL gRNA (BRDN0001148591)MASTL (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ROS1 gRNA (BRDN0001149251)ROS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ROS1 gRNA (BRDN0001149105)ROS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ROS1 gRNA (BRDN0001147358)ROS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TLK1 gRNA (BRDN0001145691)TLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TLK1 gRNA (BRDN0001147425)TLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TLK1 gRNA (BRDN0001147793)TLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TLK1 gRNA (BRDN0001146841)TLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK26 gRNA (BRDN0001149000)STK26 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK26 gRNA (BRDN0001146165)STK26 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK26 gRNA (BRDN0001149381)STK26 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK26 gRNA (BRDN0001148628)STK26 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCD gRNA (BRDN0001145526)PRKCD (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCD gRNA (BRDN0001147700)PRKCD (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCD gRNA (BRDN0001147061)PRKCD (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K10 gRNA (BRDN0001148030)MAP3K10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K10 gRNA (BRDN0001145582)MAP3K10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K10 gRNA (BRDN0001146111)MAP3K10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK4 gRNA (BRDN0001148283)ULK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK4 gRNA (BRDN0001145110)ULK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK4 gRNA (BRDN0001145330)ULK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK4 gRNA (BRDN0001147343)ULK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K6 gRNA (BRDN0001162255)MAP3K6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K6 gRNA (BRDN0001144737)MAP3K6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K6 gRNA (BRDN0001146318)MAP3K6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K6 gRNA (BRDN0001162229)MAP3K6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K3 gRNA (BRDN0001148097)MAP3K3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K3 gRNA (BRDN0001149355)MAP3K3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K3 gRNA (BRDN0001147001)MAP3K3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DAPK2 gRNA (BRDN0001145554)DAPK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DAPK2 gRNA (BRDN0001149451)DAPK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DAPK2 gRNA (BRDN0001149391)DAPK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DAPK2 gRNA (BRDN0001144830)DAPK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LATS1 gRNA (BRDN0001148404)LATS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LATS1 gRNA (BRDN0001146581)LATS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LATS1 gRNA (BRDN0001146897)LATS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LATS1 gRNA (BRDN0001147815)LATS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK19 gRNA (BRDN0001145122)STK19 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK19 gRNA (BRDN0001147911)STK19 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK19 gRNA (BRDN0001148415)STK19 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK19 gRNA (BRDN0001144764)STK19 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GUCY2D gRNA (BRDN0001146790)GUCY2D (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GUCY2D gRNA (BRDN0001146190)GUCY2D (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GUCY2D gRNA (BRDN0001147902)GUCY2D (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GUCY2D gRNA (BRDN0001145533)GUCY2D (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ANKK1 gRNA (BRDN0001149290)ANKK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ANKK1 gRNA (BRDN0001149403)ANKK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ANKK1 gRNA (BRDN0001146770)ANKK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ANKK1 gRNA (BRDN0001149535)ANKK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP2K6 gRNA (BRDN0001145878)MAP2K6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP2K6 gRNA (BRDN0001145312)MAP2K6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP2K6 gRNA (BRDN0001147036)MAP2K6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ROR1 gRNA (BRDN0001147493)ROR1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ROR1 gRNA (BRDN0001162245)ROR1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ROR1 gRNA (BRDN0001162233)ROR1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ROR1 gRNA (BRDN0001145812)ROR1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LIMK1 gRNA (BRDN0001144875)LIMK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LIMK1 gRNA (BRDN0001144894)LIMK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LIMK1 gRNA (BRDN0001148029)LIMK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LIMK1 gRNA (BRDN0001147777)LIMK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SCYL2 gRNA (BRDN0001145947)SCYL2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SCYL2 gRNA (BRDN0001148262)SCYL2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SCYL2 gRNA (BRDN0001146013)SCYL2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STRADA gRNA (BRDN0001145789)STRADA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STRADA gRNA (BRDN0001148926)STRADA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STRADA gRNA (BRDN0001145392)STRADA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STRADA gRNA (BRDN0001149192)STRADA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KB2 gRNA (BRDN0001146372)RPS6KB2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KB2 gRNA (BRDN0001146023)RPS6KB2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RPS6KB2 gRNA (BRDN0001146316)RPS6KB2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MET gRNA (BRDN0001145767)MET (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MET gRNA (BRDN0001147560)MET (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MET gRNA (BRDN0001147542)MET (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MET gRNA (BRDN0001147257)MET (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SCYL1 gRNA (BRDN0001148650)SCYL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SCYL1 gRNA (BRDN0001146995)SCYL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SCYL1 gRNA (BRDN0001144725)SCYL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGFR1 gRNA (BRDN0001145494)FGFR1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGFR1 gRNA (BRDN0001146877)FGFR1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGFR1 gRNA (BRDN0001146517)FGFR1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK39 gRNA (BRDN0001146271)STK39 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK39 gRNA (BRDN0001145870)STK39 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK39 gRNA (BRDN0001147207)STK39 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK39 gRNA (BRDN0001148139)STK39 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK4 gRNA (BRDN0001149002)STK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK4 gRNA (BRDN0001147987)STK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK4 gRNA (BRDN0001148451)STK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK7 gRNA (BRDN0001162216)CDK7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK7 gRNA (BRDN0001146106)CDK7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK7 gRNA (BRDN0001162589)CDK7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK7 gRNA (BRDN0001147450)CDK7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ALPK1 gRNA (BRDN0001146035)ALPK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ALPK1 gRNA (BRDN0001146195)ALPK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ALPK1 gRNA (BRDN0001145294)ALPK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ALPK1 gRNA (BRDN0001146875)ALPK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADCK1 gRNA (BRDN0001147030)ADCK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADCK1 gRNA (BRDN0001146894)ADCK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ADCK1 gRNA (BRDN0001149367)ADCK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IKBKB gRNA (BRDN0001145640)IKBKB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IKBKB gRNA (BRDN0001145616)IKBKB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IKBKB gRNA (BRDN0001145579)IKBKB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IKBKB gRNA (BRDN0001148638)IKBKB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BRD3 gRNA (BRDN0001146442)BRD3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BRD3 gRNA (BRDN0001149039)BRD3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BRD3 gRNA (BRDN0001147217)BRD3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BRD3 gRNA (BRDN0001148860)BRD3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA10 gRNA (BRDN0001146992)EPHA10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA10 gRNA (BRDN0001144827)EPHA10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA10 gRNA (BRDN0001146813)EPHA10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA10 gRNA (BRDN0001146043)EPHA10 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K15 gRNA (BRDN0001149244)MAP3K15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K15 gRNA (BRDN0001147819)MAP3K15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K15 gRNA (BRDN0001146305)MAP3K15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAST3 gRNA (BRDN0001145286)MAST3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAST3 gRNA (BRDN0001147549)MAST3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAST3 gRNA (BRDN0001147113)MAST3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL4 gRNA (BRDN0001146173)CDKL4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL4 gRNA (BRDN0001149006)CDKL4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL4 gRNA (BRDN0001149476)CDKL4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL4 gRNA (BRDN0001147188)CDKL4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRPM7 gRNA (BRDN0001148025)TRPM7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRPM7 gRNA (BRDN0001146152)TRPM7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRPM7 gRNA (BRDN0001147821)TRPM7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRPM7 gRNA (BRDN0001145424)TRPM7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
OBSCN gRNA (BRDN0001145479)OBSCN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
OBSCN gRNA (BRDN0001147726)OBSCN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
OBSCN gRNA (BRDN0001146767)OBSCN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK5 gRNA (BRDN0001146851)NEK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK5 gRNA (BRDN0001144996)NEK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK5 gRNA (BRDN0001148329)NEK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK5 gRNA (BRDN0001148037)NEK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAST1 gRNA (BRDN0001149113)MAST1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAST1 gRNA (BRDN0001145937)MAST1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAST1 gRNA (BRDN0001148834)MAST1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAST1 gRNA (BRDN0001148956)MAST1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK1 gRNA (BRDN0001146251)NEK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK1 gRNA (BRDN0001149235)NEK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK1 gRNA (BRDN0001148922)NEK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK1 gRNA (BRDN0001145167)NEK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYT1 gRNA (BRDN0001147389)MYT1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYT1 gRNA (BRDN0001149058)MYT1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYT1 gRNA (BRDN0001148099)MYT1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BAZ1B gRNA (BRDN0001144929)BAZ1B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BAZ1B gRNA (BRDN0001145459)BAZ1B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BAZ1B gRNA (BRDN0001147144)BAZ1B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IP6K1 gRNA (BRDN0001147847)IP6K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IP6K1 gRNA (BRDN0001149166)IP6K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IP6K1 gRNA (BRDN0001148869)IP6K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IP6K1 gRNA (BRDN0001146092)IP6K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRIM28 gRNA (BRDN0001162487)TRIM28 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRIM28 gRNA (BRDN0001162440)TRIM28 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRIM28 gRNA (BRDN0001145369)TRIM28 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TRIM28 gRNA (BRDN0001146162)TRIM28 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CLP1 gRNA (BRDN0001146849)CLP1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CLP1 gRNA (BRDN0001148453)CLP1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CLP1 gRNA (BRDN0001145024)CLP1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CLP1 gRNA (BRDN0001146499)CLP1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
OSR1 gRNA (BRDN0001146927)OSR1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
OSR1 gRNA (BRDN0001145611)OSR1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
OSR1 gRNA (BRDN0001145425)OSR1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKAR2B gRNA (BRDN0001147301)PRKAR2B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKAR2B gRNA (BRDN0001147315)PRKAR2B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKAR2B gRNA (BRDN0001147707)PRKAR2B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
AGK gRNA (BRDN0001147162)AGK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
AGK gRNA (BRDN0001146005)AGK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
AGK gRNA (BRDN0001146482)AGK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DLG3 gRNA (BRDN0001147306)DLG3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DLG3 gRNA (BRDN0001145728)DLG3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DLG3 gRNA (BRDN0001149280)DLG3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK3 gRNA (BRDN0001145678)ULK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK3 gRNA (BRDN0001145965)ULK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK3 gRNA (BRDN0001162314)ULK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ULK3 gRNA (BRDN0001162437)ULK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3CD gRNA (BRDN0001146527)PIK3CD (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3CD gRNA (BRDN0001146545)PIK3CD (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ETNK2 gRNA (BRDN0001149182)ETNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ETNK2 gRNA (BRDN0001149328)ETNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ETNK2 gRNA (BRDN0001147513)ETNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ETNK2 gRNA (BRDN0001149306)ETNK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME4 gRNA (BRDN0001147482)NME4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME4 gRNA (BRDN0001149238)NME4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME4 gRNA (BRDN0001145289)NME4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LMTK2 gRNA (BRDN0001145198)LMTK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LMTK2 gRNA (BRDN0001145764)LMTK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LMTK2 gRNA (BRDN0001148094)LMTK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK4 gRNA (BRDN0001145730)CDK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK4 gRNA (BRDN0001147537)CDK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK4 gRNA (BRDN0001147572)CDK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NTRK3 gRNA (BRDN0001145045)NTRK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NTRK3 gRNA (BRDN0001145325)NTRK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NTRK3 gRNA (BRDN0001147858)NTRK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGFR2 gRNA (BRDN0001148071)FGFR2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGFR2 gRNA (BRDN0001147365)FGFR2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FGFR2 gRNA (BRDN0001149360)FGFR2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RAB11FIP5 gRNA (BRDN0001148210)RAB11FIP5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RAB11FIP5 gRNA (BRDN0001147136)RAB11FIP5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RAB11FIP5 gRNA (BRDN0001148953)RAB11FIP5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CSNK1A1 gRNA (BRDN0001149315)CSNK1A1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CSNK1A1 gRNA (BRDN0001145680)CSNK1A1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CSNK1A1 gRNA (BRDN0001145896)CSNK1A1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3CB gRNA (BRDN0001147701)PIK3CB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3CB gRNA (BRDN0001145915)PIK3CB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3CB gRNA (BRDN0001145643)PIK3CB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3CB gRNA (BRDN0001147768)PIK3CB (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERBB4 gRNA (BRDN0001162372)ERBB4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERBB4 gRNA (BRDN0001149467)ERBB4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERBB4 gRNA (BRDN0001146197)ERBB4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERBB4 gRNA (BRDN0001162324)ERBB4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPS1 gRNA (BRDN0001147960)PRPS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPS1 gRNA (BRDN0001147441)PRPS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPS1 gRNA (BRDN0001146971)PRPS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPS1 gRNA (BRDN0001147353)PRPS1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PASK gRNA (BRDN0001145672)PASK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PASK gRNA (BRDN0001149035)PASK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PASK gRNA (BRDN0001148005)PASK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SGK2 gRNA (BRDN0001145816)SGK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SGK2 gRNA (BRDN0001148976)SGK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SGK2 gRNA (BRDN0001149504)SGK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SGK2 gRNA (BRDN0001147898)SGK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP2K1 gRNA (BRDN0001145794)MAP2K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP2K1 gRNA (BRDN0001147078)MAP2K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP2K1 gRNA (BRDN0001147218)MAP2K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP2K1 gRNA (BRDN0001146127)MAP2K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK2 gRNA (BRDN0001146193)NEK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK2 gRNA (BRDN0001145653)NEK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK2 gRNA (BRDN0001145920)NEK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
AKT3 gRNA (BRDN0001146868)AKT3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
AKT3 gRNA (BRDN0001144935)AKT3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
AKT3 gRNA (BRDN0001145071)AKT3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
AKT3 gRNA (BRDN0001147841)AKT3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME6 gRNA (BRDN0001148253)NME6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME6 gRNA (BRDN0001145496)NME6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME6 gRNA (BRDN0001146177)NME6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYO3A gRNA (BRDN0001145770)MYO3A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYO3A gRNA (BRDN0001148088)MYO3A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MYO3A gRNA (BRDN0001146256)MYO3A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TYRO3 gRNA (BRDN0001147880)TYRO3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TYRO3 gRNA (BRDN0001146050)TYRO3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TYRO3 gRNA (BRDN0001147403)TYRO3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CLK1 gRNA (BRDN0001146512)CLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CLK1 gRNA (BRDN0001147209)CLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CLK1 gRNA (BRDN0001146454)CLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CLK1 gRNA (BRDN0001147408)CLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK4 gRNA (BRDN0001146388)PLK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK4 gRNA (BRDN0001147289)PLK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK4 gRNA (BRDN0001147082)PLK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMK2G gRNA (BRDN0001148688)CAMK2G (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMK2G gRNA (BRDN0001148569)CAMK2G (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CAMK2G gRNA (BRDN0001147974)CAMK2G (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FRK gRNA (BRDN0001144749)FRK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FRK gRNA (BRDN0001149083)FRK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FRK gRNA (BRDN0001146590)FRK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FRK gRNA (BRDN0001148904)FRK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TSSK6 gRNA (BRDN0001147567)TSSK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TSSK6 gRNA (BRDN0001148928)TSSK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TSSK6 gRNA (BRDN0001146415)TSSK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA6 gRNA (BRDN0001146458)EPHA6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA6 gRNA (BRDN0001145443)EPHA6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA6 gRNA (BRDN0001146068)EPHA6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK13 gRNA (BRDN0001149329)MAPK13 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK13 gRNA (BRDN0001145247)MAPK13 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK13 gRNA (BRDN0001145708)MAPK13 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKAA1 gRNA (BRDN0001146526)PRKAA1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKAA1 gRNA (BRDN0001147273)PRKAA1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKAA1 gRNA (BRDN0001149089)PRKAA1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK6 gRNA (BRDN0001147000)NEK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK6 gRNA (BRDN0001144960)NEK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NEK6 gRNA (BRDN0001148151)NEK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MINK1 gRNA (BRDN0001144839)MINK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MINK1 gRNA (BRDN0001146260)MINK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MINK1 gRNA (BRDN0001145021)MINK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MINK1 gRNA (BRDN0001147795)MINK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP4K4 gRNA (BRDN0001148610)MAP4K4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP4K4 gRNA (BRDN0001162594)MAP4K4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP4K4 gRNA (BRDN0001146036)MAP4K4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP4K4 gRNA (BRDN0001162353)MAP4K4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL1 gRNA (BRDN0001148660)CDKL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL1 gRNA (BRDN0001148269)CDKL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL1 gRNA (BRDN0001147644)CDKL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDKL1 gRNA (BRDN0001148261)CDKL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK5 gRNA (BRDN0001149126)GRK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK5 gRNA (BRDN0001149298)GRK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK5 gRNA (BRDN0001149127)GRK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK5 gRNA (BRDN0001148840)GRK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKN1 gRNA (BRDN0001149250)PKN1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKN1 gRNA (BRDN0001162227)PKN1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKN1 gRNA (BRDN0001148556)PKN1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKN1 gRNA (BRDN0001162558)PKN1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SRM gRNA (BRDN0001147064)SRM (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SRM gRNA (BRDN0001149020)SRM (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
SRM gRNA (BRDN0001147759)SRM (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RP2 gRNA (BRDN0001148096)RP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RP2 gRNA (BRDN0001145650)RP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RP2 gRNA (BRDN0001144983)RP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RP2 gRNA (BRDN0001145706)RP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PCK1 gRNA (BRDN0001146891)PCK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PCK1 gRNA (BRDN0001148468)PCK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PCK1 gRNA (BRDN0001145528)PCK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PCK1 gRNA (BRDN0001146817)PCK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TGFBR3 gRNA (BRDN0001145124)TGFBR3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TGFBR3 gRNA (BRDN0001146153)TGFBR3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TGFBR3 gRNA (BRDN0001144841)TGFBR3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PANK3 gRNA (BRDN0001148432)PANK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PANK3 gRNA (BRDN0001148598)PANK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PANK3 gRNA (BRDN0001144785)PANK3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DSTYK gRNA (BRDN0001147753)DSTYK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DSTYK gRNA (BRDN0001148274)DSTYK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
DSTYK gRNA (BRDN0001146496)DSTYK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKRA gRNA (BRDN0001146443)PRKRA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKRA gRNA (BRDN0001147957)PRKRA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKRA gRNA (BRDN0001146546)PRKRA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FASTKD2 gRNA (BRDN0001145464)FASTKD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FASTKD2 gRNA (BRDN0001147886)FASTKD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FASTKD2 gRNA (BRDN0001148171)FASTKD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FASTKD2 gRNA (BRDN0001148576)FASTKD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PPIP5K1 gRNA (BRDN0001146565)PPIP5K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PPIP5K1 gRNA (BRDN0001146986)PPIP5K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PPIP5K1 gRNA (BRDN0001148626)PPIP5K1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HK2 gRNA (BRDN0001162236)HK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HK2 gRNA (BRDN0001162212)HK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HK2 gRNA (BRDN0001162355)HK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
HK2 gRNA (BRDN0001149267)HK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NRK gRNA (BRDN0001146231)NRK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NRK gRNA (BRDN0001147558)NRK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NRK gRNA (BRDN0001144922)NRK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAPSS2 gRNA (BRDN0001145342)PAPSS2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAPSS2 gRNA (BRDN0001147912)PAPSS2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAPSS2 gRNA (BRDN0001146774)PAPSS2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKD2 gRNA (BRDN0001148691)PKD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKD2 gRNA (BRDN0001144799)PKD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PKD2 gRNA (BRDN0001146258)PKD2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NAGK gRNA (BRDN0001148128)NAGK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NAGK gRNA (BRDN0001148511)NAGK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NAGK gRNA (BRDN0001146503)NAGK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NAGK gRNA (BRDN0001146760)NAGK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GK gRNA (BRDN0001148115)GK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GK gRNA (BRDN0001145307)GK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GK gRNA (BRDN0001146936)GK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GK gRNA (BRDN0001146383)GK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CERK gRNA (BRDN0001148273)CERK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CERK gRNA (BRDN0001145454)CERK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CERK gRNA (BRDN0001146528)CERK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3CG gRNA (BRDN0001147429)PIK3CG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3CG gRNA (BRDN0001149186)PIK3CG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3CG gRNA (BRDN0001149132)PIK3CG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
N4BP2 gRNA (BRDN0001146240)N4BP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
N4BP2 gRNA (BRDN0001146515)N4BP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
N4BP2 gRNA (BRDN0001146056)N4BP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PPIP5K2 gRNA (BRDN0001148509)PPIP5K2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PPIP5K2 gRNA (BRDN0001146353)PPIP5K2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PPIP5K2 gRNA (BRDN0001148255)PPIP5K2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3R3 gRNA (BRDN0001145523)PIK3R3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3R3 gRNA (BRDN0001147854)PIK3R3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3R3 gRNA (BRDN0001146614)PIK3R3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
UCKL1 gRNA (BRDN0001146668)UCKL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
UCKL1 gRNA (BRDN0001162217)UCKL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
UCKL1 gRNA (BRDN0001147183)UCKL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
UCKL1 gRNA (BRDN0001162519)UCKL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ROCK2 gRNA (BRDN0001147800)ROCK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ROCK2 gRNA (BRDN0001146481)ROCK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ROCK2 gRNA (BRDN0001145177)ROCK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHB4 gRNA (BRDN0001144879)EPHB4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHB4 gRNA (BRDN0001148436)EPHB4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHB4 gRNA (BRDN0001145313)EPHB4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PHKG1 gRNA (BRDN0001147570)PHKG1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PHKG1 gRNA (BRDN0001144981)PHKG1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PHKG1 gRNA (BRDN0001147981)PHKG1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TXK gRNA (BRDN0001145857)TXK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TXK gRNA (BRDN0001145866)TXK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TXK gRNA (BRDN0001146212)TXK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TBK1 gRNA (BRDN0001145663)TBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TBK1 gRNA (BRDN0001148392)TBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TBK1 gRNA (BRDN0001148607)TBK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K11 gRNA (BRDN0001146472)MAP3K11 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K11 gRNA (BRDN0001145849)MAP3K11 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K11 gRNA (BRDN0001144833)MAP3K11 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA2 gRNA (BRDN0001146397)EPHA2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA2 gRNA (BRDN0001147157)EPHA2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
EPHA2 gRNA (BRDN0001147488)EPHA2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GSK3A gRNA (BRDN0001148594)GSK3A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GSK3A gRNA (BRDN0001148086)GSK3A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GSK3A gRNA (BRDN0001147712)GSK3A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK32B gRNA (BRDN0001146403)STK32B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK32B gRNA (BRDN0001145394)STK32B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK32B gRNA (BRDN0001144884)STK32B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERBB2 gRNA (BRDN0001146057)ERBB2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERBB2 gRNA (BRDN0001148673)ERBB2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERBB2 gRNA (BRDN0001148320)ERBB2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP2K3 gRNA (BRDN0001147291)MAP2K3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP2K3 gRNA (BRDN0001146677)MAP2K3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP2K3 gRNA (BRDN0001147239)MAP2K3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIM2 gRNA (BRDN0001148470)PIM2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIM2 gRNA (BRDN0001149335)PIM2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIM2 gRNA (BRDN0001149489)PIM2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIM2 gRNA (BRDN0001147820)PIM2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PTK2B gRNA (BRDN0001148546)PTK2B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PTK2B gRNA (BRDN0001148298)PTK2B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PTK2B gRNA (BRDN0001147875)PTK2B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BMPR2 gRNA (BRDN0001146229)BMPR2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BMPR2 gRNA (BRDN0001144950)BMPR2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BMPR2 gRNA (BRDN0001144883)BMPR2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
JAK1 gRNA (BRDN0001145887)JAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
JAK1 gRNA (BRDN0001144778)JAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
JAK1 gRNA (BRDN0001149081)JAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
JAK1 gRNA (BRDN0001149025)JAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK6 gRNA (BRDN0001148999)MAPK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK6 gRNA (BRDN0001146144)MAPK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK6 gRNA (BRDN0001149260)MAPK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPK6 gRNA (BRDN0001146542)MAPK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCI gRNA (BRDN0001146507)PRKCI (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCI gRNA (BRDN0001148989)PRKCI (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCI gRNA (BRDN0001162413)PRKCI (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRKCI gRNA (BRDN0001162218)PRKCI (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP4K3 gRNA (BRDN0001145375)MAP4K3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP4K3 gRNA (BRDN0001145020)MAP4K3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP4K3 gRNA (BRDN0001147653)MAP4K3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERN1 gRNA (BRDN0001162304)ERN1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERN1 gRNA (BRDN0001146341)ERN1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERN1 gRNA (BRDN0001162231)ERN1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
ERN1 gRNA (BRDN0001149471)ERN1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LCK gRNA (BRDN0001145572)LCK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LCK gRNA (BRDN0001145503)LCK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
LCK gRNA (BRDN0001145758)LCK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3C2A gRNA (BRDN0001149181)PIK3C2A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3C2A gRNA (BRDN0001148547)PIK3C2A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3C2A gRNA (BRDN0001145757)PIK3C2A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PIK3C2A gRNA (BRDN0001149070)PIK3C2A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IRAK1 gRNA (BRDN0001145800)IRAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IRAK1 gRNA (BRDN0001147615)IRAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IRAK1 gRNA (BRDN0001145661)IRAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
IRAK1 gRNA (BRDN0001146412)IRAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TK1 gRNA (BRDN0001147866)TK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TK1 gRNA (BRDN0001147625)TK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TK1 gRNA (BRDN0001145069)TK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
KSR2 gRNA (BRDN0001147424)KSR2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
KSR2 gRNA (BRDN0001148172)KSR2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
KSR2 gRNA (BRDN0001145237)KSR2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPF4B gRNA (BRDN0001146164)PRPF4B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPF4B gRNA (BRDN0001148328)PRPF4B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPF4B gRNA (BRDN0001146471)PRPF4B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PRPF4B gRNA (BRDN0001146215)PRPF4B (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TESK2 gRNA (BRDN0001146547)TESK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TESK2 gRNA (BRDN0001149031)TESK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TESK2 gRNA (BRDN0001147688)TESK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TESK2 gRNA (BRDN0001149439)TESK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDK4 gRNA (BRDN0001145641)PDK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDK4 gRNA (BRDN0001147610)PDK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDK4 gRNA (BRDN0001148073)PDK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDK4 gRNA (BRDN0001146844)PDK4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDIK1L gRNA (BRDN0001148388)PDIK1L (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDIK1L gRNA (BRDN0001145465)PDIK1L (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDIK1L gRNA (BRDN0001145634)PDIK1L (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PDIK1L gRNA (BRDN0001147645)PDIK1L (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MERTK gRNA (BRDN0001145505)MERTK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MERTK gRNA (BRDN0001144964)MERTK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MERTK gRNA (BRDN0001146205)MERTK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPKAPK5 gRNA (BRDN0001146604)MAPKAPK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPKAPK5 gRNA (BRDN0001147153)MAPKAPK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAPKAPK5 gRNA (BRDN0001145783)MAPKAPK5 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RYK gRNA (BRDN0001149332)RYK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RYK gRNA (BRDN0001146411)RYK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
RYK gRNA (BRDN0001146690)RYK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NRBP2 gRNA (BRDN0001147825)NRBP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NRBP2 gRNA (BRDN0001147090)NRBP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NRBP2 gRNA (BRDN0001145030)NRBP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NRBP2 gRNA (BRDN0001146685)NRBP2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK1 gRNA (BRDN0001145759)PLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK1 gRNA (BRDN0001144743)PLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK1 gRNA (BRDN0001144995)PLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PLK1 gRNA (BRDN0001147678)PLK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PFKFB3 gRNA (BRDN0001147151)PFKFB3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PFKFB3 gRNA (BRDN0001146230)PFKFB3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PFKFB3 gRNA (BRDN0001147212)PFKFB3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAK1 gRNA (BRDN0001145958)PAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAK1 gRNA (BRDN0001147867)PAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PAK1 gRNA (BRDN0001145359)PAK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NTRK2 gRNA (BRDN0001146241)NTRK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NTRK2 gRNA (BRDN0001148065)NTRK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NTRK2 gRNA (BRDN0001146295)NTRK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GAK gRNA (BRDN0001146687)GAK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GAK gRNA (BRDN0001146263)GAK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GAK gRNA (BRDN0001148048)GAK (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK32A gRNA (BRDN0001146573)STK32A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK32A gRNA (BRDN0001145029)STK32A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
STK32A gRNA (BRDN0001145147)STK32A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNK1 gRNA (BRDN0001149443)TNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNK1 gRNA (BRDN0001149201)TNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
TNK1 gRNA (BRDN0001146081)TNK1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BRAF gRNA (BRDN0001145345)BRAF (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BRAF gRNA (BRDN0001146266)BRAF (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BRAF gRNA (BRDN0001146755)BRAF (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
BRAF gRNA (BRDN0001147638)BRAF (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK15 gRNA (BRDN0001145059)CDK15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK15 gRNA (BRDN0001148122)CDK15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK15 gRNA (BRDN0001146647)CDK15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK15 gRNA (BRDN0001144734)CDK15 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CHEK2 gRNA (BRDN0001145610)CHEK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CHEK2 gRNA (BRDN0001146385)CHEK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CHEK2 gRNA (BRDN0001145828)CHEK2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PTK6 gRNA (BRDN0001149364)PTK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PTK6 gRNA (BRDN0001162471)PTK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PTK6 gRNA (BRDN0001145574)PTK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
PTK6 gRNA (BRDN0001162535)PTK6 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME7 gRNA (BRDN0001146186)NME7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME7 gRNA (BRDN0001145354)NME7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME7 gRNA (BRDN0001148617)NME7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
NME7 gRNA (BRDN0001146300)NME7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK7 gRNA (BRDN0001145046)GRK7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK7 gRNA (BRDN0001147785)GRK7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
GRK7 gRNA (BRDN0001148138)GRK7 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK19 gRNA (BRDN0001149215)CDK19 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK19 gRNA (BRDN0001148843)CDK19 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK19 gRNA (BRDN0001145270)CDK19 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
CDK19 gRNA (BRDN0001148326)CDK19 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FES gRNA (BRDN0001148684)FES (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FES gRNA (BRDN0001147775)FES (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FES gRNA (BRDN0001147481)FES (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
FES gRNA (BRDN0001147807)FES (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K4 gRNA (BRDN0001148639)MAP3K4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K4 gRNA (BRDN0001148603)MAP3K4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K4 gRNA (BRDN0001148693)MAP3K4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.
MAP3K4 gRNA (BRDN0001146051)MAP3K4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Root Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.