pGL2-Basic-Myogenin core promoter
(Plasmid
#134722)
-
PurposeMyogenin core promoter in a luciferase reporter plasmid
-
Depositing Lab
-
Depositing OrganizationBrigham and Women's Hospital
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 134722-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 134722-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL2-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5597
- Total vector size (bp) 5781
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMyogenin Promoter
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)184
- Promoter Myogenin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer CTCGAGCCTGCAGGGTGGGGTGGGGG
- 3′ sequencing primer AAGCTTCCCCCAAGCTCCCGCAGCCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEric Olsen's lab and obtained through the permission of Jon Epstein. Edmondson, D. G., Cheng, T. C., Cserjesi, P., Chakraborty, T., and Olson, E. N. (1992) Mol. Cell. Biol. 12, 3665–3677
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 134722-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 134722-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL2-Basic-Myogenin core promoter was a gift from Michael Chin (Addgene plasmid # 134722 ; http://n2t.net/addgene:134722 ; RRID:Addgene_134722) -
For your References section:
Regulation of myogenic terminal differentiation by the hairy-related transcription factor CHF2. Sun J, Kamei CN, Layne MD, Jain MK, Liao JK, Lee ME, Chin MT. J Biol Chem. 2001 May 25;276(21):18591-6. doi: 10.1074/jbc.M101163200. Epub 2001 Feb 22. 10.1074/jbc.M101163200 PubMed 11279181
