Skip to main content

Ef1a-QCP-3xBFP
(Plasmid #158206)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158206 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 158206-D50 50 μg of DNA in Tris buffer $495
DNA 158206-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    Addgene number 75384
  • Modifications to backbone
    Instead of the MS2 coat protein we inserted a QB coat protein sequence.
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    QCP under the Elfa promoter and three BFP tags
  • Species
    Synthetic
  • Promoter Elfa
  • Tag / Fusion Protein
    • 3xBFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCCGTGAACGTTCTTTTTCGCAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS result found different linkers between the BFP's when compared to the backbone #75384. The depositor confirmed they observed strong BFP fluorescence and the different linkers are not a concern.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ef1a-QCP-3xBFP was a gift from Roee Amit (Addgene plasmid # 158206 ; http://n2t.net/addgene:158206 ; RRID:Addgene_158206)
  • For your References section:

    Overcoming the design, build, test bottleneck for synthesis of nonrepetitive protein-RNA cassettes. Katz N, Tripto E, Granik N, Goldberg S, Atar O, Yakhini Z, Orenstein Y, Amit R. Nat Commun. 2021 Mar 11;12(1):1576. doi: 10.1038/s41467-021-21578-6. 10.1038/s41467-021-21578-6 PubMed 33707432
Commonly requested with: