pJYDN3p
(Plasmid
#162457)
-
PurposePositive control plasmid for pJYDN3n plasmid expression attempts. It contains both eUnaG2 bilirubin dependent fluorescent protein and ALFA-tag for DnbALFA based detection on the cell surface.
-
Depositing Lab
-
Depositing OrganizationWeizmann Institute of Science
Located in Israel -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 162457-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 162457-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneNew backbone pJYD
-
Backbone manufacturerDr. Jiri Zahradnik
- Backbone size w/o insert (bp) 5254
- Total vector size (bp) 5255
-
Modifications to backboneInsertion of 1 bp and replacement of stop codons in MCS
-
Vector typeShuttle vector bacteria/yeast
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAga2p-eUnaG2
-
Insert Size (bp)939
-
Entrez GeneAGA2 (a.k.a. YGL032C)
- Promoter GAL1
-
Tags
/ Fusion Proteins
- ALFA tag (N terminal on insert)
- HA and myc tags (C terminal on insert)
- eUnaG2 fluorescent protein (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GaL1b_F primer: CCTCTATACTTTAACGTCAAGGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.12.16.423176v1 for bioRxiv preprint.
DNA (Catalog # 162457-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 162457-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJYDN3p was a gift from Gideon Schreiber (Addgene plasmid # 162457 ; http://n2t.net/addgene:162457 ; RRID:Addgene_162457) -
For your References section:
An enhanced yeast display platform demonstrates the binding plasticity under various selection pressures. Zahradník J, Dey D, Marciano S, Schreiber G. bioRxiv Preprint 2020 10.1101/2020.12.16.423176
Map uploaded by the depositor.
