Skip to main content

pcDNA3.1+(Zeo)-FLAG-muGFP
(Plasmid #166726)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166726 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 166726-D50 50 μg of DNA in Tris buffer $495
DNA 166726-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1+(Zeo)
  • Backbone size w/o insert (bp) 4985
  • Total vector size (bp) 5702
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    muGFP
  • Alt name
    monomeric ultrastable GFP
  • Alt name
    musGFP
  • Species
    synthetic/engineered
  • Insert Size (bp)
    711
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer TGGCTAACTAGAGAACCCAC
  • 3′ sequencing primer CCTACTCAGACAATGCGATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1+(Zeo)-FLAG-muGFP was a gift from Daniel Scott (Addgene plasmid # 166726 ; http://n2t.net/addgene:166726 ; RRID:Addgene_166726)
  • For your References section:

    A Novel Ultra-Stable, Monomeric Green Fluorescent Protein For Direct Volumetric Imaging of Whole Organs Using CLARITY. Scott DJ, Gunn NJ, Yong KJ, Wimmer VC, Veldhuis NA, Challis LM, Haidar M, Petrou S, Bathgate RAD, Griffin MDW. Sci Rep. 2018 Jan 12;8(1):667. doi: 10.1038/s41598-017-18045-y. 10.1038/s41598-017-18045-y PubMed 29330459