pYL-kasOp-FnCas12a2
(Plasmid
#177874)
-
PurposeExpresses Streptomyces codon optimized FnCas12a. Used to modify genome of Streptomyces.
-
Depositing Lab
-
Depositing OrganizationTianjin University (INACTIVE)
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 177874-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 177874-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCRISPomyces-2
- Backbone size w/o insert (bp) -1
-
Vector typeCRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStreptomyces codon optimized FnCas12a
-
Alt nameFnCas12a
-
Alt nameFnCpf1
-
SpeciesStreptomyces
-
Insert Size (bp)3909
- Promoter kasOp*
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCGAACAGGCCATTCACAGA
- 3′ sequencing primer TCTGACGCTCAGTGGAACGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 177874-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 177874-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYL-kasOp-FnCas12a2 was a gift from Yunzi Luo (Addgene plasmid # 177874 ; http://n2t.net/addgene:177874 ; RRID:Addgene_177874) -
For your References section:
Efficient Multiplex Genome Editing in Streptomyces via Engineered CRISPR-Cas12a Systems. Zhang J, Zhang D, Zhu J, Liu H, Liang S, Luo Y. Front Bioeng Biotechnol. 2020 Jun 30;8:726. doi: 10.3389/fbioe.2020.00726. eCollection 2020. 10.3389/fbioe.2020.00726 PubMed 32695773
Map uploaded by the depositor.
