Skip to main content

pYL-kasOp-FnCas12a2
(Plasmid #177874)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177874 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 177874-D50 50 μg of DNA in Tris buffer $495
DNA 177874-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCRISPomyces-2
  • Backbone size w/o insert (bp) -1
  • Vector type
    CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Streptomyces codon optimized FnCas12a
  • Alt name
    FnCas12a
  • Alt name
    FnCpf1
  • Species
    Streptomyces
  • Insert Size (bp)
    3909
  • Promoter kasOp*

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACCGAACAGGCCATTCACAGA
  • 3′ sequencing primer TCTGACGCTCAGTGGAACGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYL-kasOp-FnCas12a2 was a gift from Yunzi Luo (Addgene plasmid # 177874 ; http://n2t.net/addgene:177874 ; RRID:Addgene_177874)
  • For your References section:

    Efficient Multiplex Genome Editing in Streptomyces via Engineered CRISPR-Cas12a Systems. Zhang J, Zhang D, Zhu J, Liu H, Liang S, Luo Y. Front Bioeng Biotechnol. 2020 Jun 30;8:726. doi: 10.3389/fbioe.2020.00726. eCollection 2020. 10.3389/fbioe.2020.00726 PubMed 32695773