pAcBac1-GFP(39TAG)
(Plasmid #217360)

• Purpose: Expression of reporter EGFP with a TAG stop codon at 39 aa position; can be packaged into bacmid
• Depositing Lab: Abhishek Chatterjee
• Depositing Organization: Boston College
  Located in the United States of America
• Publication: Jewel et al Nat Methods. 2023 Jan;20(1):95-103. doi: 10.1038/s41592-022-01706-w. Epub 2022 Dec 22.

Backbone

• Vector backbone: pAcBac1-EGFP
• Backbone manufacturer: derived from pFastBac-Dual from Invitrogen.
• Backbone size w/o insert (bp): 7942
• Total vector size (bp): 8755
• Modifications to backbone: replaced eGFP wild type with eGFP-Y39TAG from overlap PCR using restriction enzymes EcoRI and NheI
• Vector type: Mammalian Expression, Insect Expression ; baculoviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Gentamicin, 100 & 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Enhanced green fluorescent protein
• Alt name: eGFP
• Alt name: eGFP-Y39TAG
• Alt name: GFP(39TAG)
• Insert Size (bp): 782
• Mutation: Y39TAG
• GenBank ID: 8382257
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAAGGAGGAGAAAATGAAAGCCATACGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

the 39 amino acid position for Y39TAG is relative to the fully processed eGFP (i.e. the numbering for amino acid position starts after the methionine start codon that is removed from eGFP post-translationally).

DNA (Catalog # 217360-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 217360-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.