-
PurposeExpresses the MS2-P65-HSF1 activator helper complex with a 2A GFP. 3rd generation lentiviral vector.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelenti(AMP)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersZeo marker is outside the LTRs and will not be packaged into virus.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsnone
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMS2(N55K)-P65-HSF1_2A_GFP
-
SpeciesH. sapiens (human), Synthetic
-
MutationN55K in MS2
-
Entrez GeneHSF1 (a.k.a. HSTF1)
- Promoter EF1A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTT TGG ATC TTG GTT CAT TCT CAA GCC TCA G
- 3′ sequencing primer cacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MS2-P65-HSF1_GFP was a gift from Feng Zhang (Addgene plasmid # 61423 ; http://n2t.net/addgene:61423 ; RRID:Addgene_61423) -
For your References section:
Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202