-
Purpose(Empty Backbone) sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Cloning Grade DNA | 61424-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $105 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
-
Vector typeMammalian Expression, CRISPR
- Promoter U6
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsnone
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CACCTCTGACTTGAGCGTCGATTTTTGTG
- 3′ sequencing primer CCCGCCGCGCTTAATGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/
Information for Cloning Grade DNA (Catalog # 61424-DNA.cg) ( Back to top )
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $105 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA(MS2) cloning backbone was a gift from Feng Zhang (Addgene plasmid # 61424 ; http://n2t.net/addgene:61424 ; RRID:Addgene_61424) -
For your References section:
Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202