VWF-pHluorin-mRFP
(Plasmid #234367)

• Purpose: Von Willebrand factor fused in tandem to superecliptic pHluorin and inserted into pmRFP1-N1 vector from Addgene (Plasmid No: 54635)/Monitoring of WPB pH, Visualization of WPB exocytosis
• Depositing Lab: Volker Gerke
• Depositing Organization: Universitaetsklinikum Muenster
  Located in Germany
• Publication: Terglane et al PLoS One. 2022 Jun 29;17(6):e0270299. doi: 10.1371/journal.pone.0270299. eCollection 2022.

Backbone

• Vector backbone: pmRFP1-N1
• Backbone manufacturer: Robert Campbell & Michael Davidson & Roger Tsien (Addgene plasmid # 54635)
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Von Willebrand factor
• Species: H. sapiens (human)
• Insert Size (bp): 8441
• Entrez Gene: VWF (a.k.a. F8VWF, VWD)
• Tag / Fusion Protein:
  • pHluorin (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CCTCTACAAATGTGGTATGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: VWF-pHluorin was obtained by replacing mRFP in a VWF-mRFP plasmid, which was kindly provided by Tom Carter (St. George´s University of London, UK) [Babich et al. 2008 Selective release of molecules from Weibel-Palade bodies during a lingering kiss, Hannah et al. 2005 Differential kinetics of cell surface loss of von Willebrand factor and its propolypeptide after secretion from Weibel-palade bodies in living human endothelial cells], with superecliptic pHluorin (courtesy of Anja Biesemann, Institute of Medical Biochemistry, University of Muenster).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 234367-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 234367-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.