Skip to main content

pQdCas12a.sggfp(C)
(Plasmid #236042)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 236042 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 236042-D50 50 μg of DNA in Tris buffer $495
DNA 236042-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBBRMCS2
  • Backbone size w/o insert (bp) 3876
  • Total vector size (bp) 9782
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    the plasmid is stable in both 30 and 37 centigrade in E. coli. the plasmid is stable in 30 centigrade in P. putida.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    quorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
  • Promoter quorum sensing promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGGATCTCGTCGTGACCCATG
  • 3′ sequencing primer AAACGGAGGAATGGGAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQdCas12a.sggfp(C) was a gift from Radhakrishnan Mahadevan (Addgene plasmid # 236042 ; http://n2t.net/addgene:236042 ; RRID:Addgene_236042)
  • For your References section:

    Model-Based Optimization of a qCRISPRi Circuit for Dynamic Control of Metabolic Pathways. Golla SA, Abo-Hashesh M, Gupta D, Liu Y, Mahadevan R. ACS Synth Biol. 2025 Oct 17;14(10):3890-3898. doi: 10.1021/acssynbio.5c00095. Epub 2025 Sep 29. 10.1021/acssynbio.5c00095 PubMed 41021780