-
PurposeExpresses improved CRY2PHR homo-oligomerization
-
Depositing Lab
-
Depositing OrganizationInstitute for Basic Science
Located in the Republic of Korea -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 105624-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 105624-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmCherry-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4658
- Total vector size (bp) 6179
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry-CRY2PHR-9aa
-
Alt namemCherry-CRY2clust
-
Alt name839529
-
SpeciesH. sapiens (human), A. thaliana (mustard weed)
-
Insert Size (bp)1521
-
Entrez GeneCRY2 (a.k.a. AT1G04400, AT-PHH1, ATCRY2, CRYPTOCHROME 2 APOPROTEIN, F19P19.14, F19P19_14, FHA, PHH1, cryptochrome 2)
- Promoter CMV
-
Tag
/ Fusion Protein
- 9 amino acids (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site MfeI (not destroyed)
- 5′ sequencing primer ATGAAGATGGACAAAAAGACCATCGTCTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 105624-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 105624-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-CRY2clust was a gift from Won Do Heo (Addgene plasmid # 105624 ; http://n2t.net/addgene:105624 ; RRID:Addgene_105624) -
For your References section:
Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2. Park H, Kim NY, Lee S, Kim N, Kim J, Heo WD. Nat Commun. 2017 Jun 23;8(1):30. doi: 10.1038/s41467-017-00060-2. 10.1038/s41467-017-00060-2 PubMed 28646204