-
PurposeStrong CAG promoter with mCherry expression for transfection efficacy screening
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108685 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 108685-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 108685-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneColE1
- Backbone size w/o insert (bp) 4888
- Total vector size (bp) 5599
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)795
- Promoter CAG
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TACAGCTCCTGGGCAACGTG
- 3′ sequencing primer CCC ATA TGT CCT TCC GAG TG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKarl Wahlin
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/02/13/264390 for bioRxiv preprint.
DNA (Catalog # 108685-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 108685-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-mCherry was a gift from Jordan Green (Addgene plasmid # 108685 ; http://n2t.net/addgene:108685 ; RRID:Addgene_108685) -
For your References section:
A combinatorial library of biodegradable polyesters enables non-viral gene delivery to post-mitotic human stem cell-derived polarized RPE monolayers. Mishra B, Wilson DR, Sripathi SR, Suprenant MP, Rui Y, Wahlin KJ, Berlinicke CA, Green JJ, Zack DJ. Regen Eng Transl Med. 2019 Sep;6(3):273-285. doi: 10.1007/s40883-019-00118-1. Epub 2019 Jul 24. 10.1007/s40883-019-00118-1 PubMed 33732871