A3Bi-ctd-Cas9n-UGI-NLS
(Plasmid #109426)

• Purpose: Expresses the C-terminal catalytic domain of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.
• Depositing Lab: Reuben Harris
• Depositing Organization: University of Minnesota
  Located in United States of America
• Publication: St Martin et al Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332.
• Citations: 1 Article

Backbone

• Vector backbone: BE3
• Backbone manufacturer: David Liu
• Backbone size w/o insert (bp): 7825
• Total vector size (bp): 9294
• Modifications to backbone: Removed rat APOBEC1 and replaced it with the catalytically-active C-terminal domain of human APOBEC3B
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain
• Alt name: APOBEC3B C-terminal Domain
• Alt name: A3Bctd
• Species: H. sapiens (human)
• Insert Size (bp): 1469
• Mutation: Insertion of an L1 intron into the coding sequence of A3B to prevent mutation in E. coli, only cloned the catalytically-active C-terminal domain
• Entrez Gene: APOBEC3B (a.k.a. A3B, APOBEC1L, ARCD3, ARP4, DJ742C19.2, PHRBNL, bK150C2.2)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: CGTGTACGGTGGGAGGTCTA
• 3′ sequencing primer: CAAAGAAGGAACCAGGTCCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 109426-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 109426-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.