Skip to main content

pENTR-EF1adCas9VP64_T2A_MS2p65HSF1-IRESbsdpA
(Plasmid #112922)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112922 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 112922-D50 50 μg of DNA in Tris buffer $495
DNA 112922-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pENTR
  • Backbone size w/o insert (bp) 2267
  • Total vector size (bp) 11063
  • Vector type
    Mammalian Expression, Gateway Cloning
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EF1a promoter, dCas9VP94, MS2p65HSF1, IRESneo
  • Species
    Synthetic
  • Insert Size (bp)
    8796

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer ATGTAATTCTCCTTGGAATTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR-EF1adCas9VP64_T2A_MS2p65HSF1-IRESbsdpA was a gift from Kosuke Yusa (Addgene plasmid # 112922 ; http://n2t.net/addgene:112922 ; RRID:Addgene_112922)
  • For your References section:

    Pooled extracellular receptor-ligand interaction screening using CRISPR activation. Chong ZS, Ohnishi S, Yusa K, Wright GJ. Genome Biol. 2018 Nov 26;19(1):205. doi: 10.1186/s13059-018-1581-3. 10.1186/s13059-018-1581-3 PubMed 30477585