Skip to main content

pcDNA3.1+DPP6
(Plasmid #117272)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117272 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 117272-D50 50 μg of DNA in Tris buffer $495
DNA 117272-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1+
  • Backbone manufacturer
    Genescript
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7982
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DPP6
  • Alt name
    DPP6
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_130797.3
  • Entrez Gene
    DPP6 (a.k.a. DPL1, DPPX, MRD33, VF2)
  • Promoter CMV

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1+DPP6 was a gift from Mark Cannell (Addgene plasmid # 117272 ; http://n2t.net/addgene:117272 ; RRID:Addgene_117272)
  • For your References section:

    Regulation of Kv4.3 and hERG potassium channels by KChIP2 isoforms and DPP6 and response to the dual K(+) channel activator NS3623. Lainez S, Doray A, Hancox JC, Cannell MB. Biochem Pharmacol. 2018 Apr;150:120-130. doi: 10.1016/j.bcp.2018.01.036. Epub 2018 Jan 31. 10.1016/j.bcp.2018.01.036 PubMed 29378180