1
Plasmid 13031: pcDNA3-EGFP
  • Mammalian expression vector for cloning your gene fused to EGFP

  • Enhanced Green Fluorescent Protein

  • EGFP

  • GFP

  • 700

  • pcDNA3
    (Search Vector Database)

  • Mammalian Expression

  • 5446

  • XhoI

  • No

  • XbaI

  • No

  • T7 List of Sequencing Primers

  • GTCTTGTAGTTGCCGTCGTC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • EGFP from discontinued clonetech vector.

  • View sequences (2)
  • Doug Golenbock

  • UBMTA
    Ancillary Agreement for Plasmids Containing FP Materials

Comments: 

The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 13031" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only