1
Plasmid 13033: pcDNA3-YFP
  • Yellow fluorescent protein

  • YFP

  • EYFP

  • 720

  • pcDNA3
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 5446

  • XhoI

  • No

  • XbaI

  • No

  • T7 List of Sequencing Primers

  • GTCTTGTAGTTGCCGTCGTC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • YFP from discontinued clonetech vector.

  • View sequences (3)
  • Doug Golenbock

  • MTA

Comments: 

The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 13033" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only