The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'
Addgene has sequenced a portion of this plasmid for verification.
Click here for the sequencing
result.
Please acknowledge the principal investigator and cite this article if you use
this plasmid in a publication. Also, please include the text "Addgene plasmid
13033" in your Materials and Methods section.
The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'