-
Depositing Lab
-
Depositing OrganizationNational Cancer Institute (NCI)
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 13390 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 13390-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 13390-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4693
-
Vector typeMammalian Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namevon Hippel-Lindau
-
Alt nameVHL
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)572
-
GenBank IDNM_052801
-
Entrez GeneVhl (a.k.a. Vhlh)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer tctcgagctcaagcttcgg
- 3′ sequencing primer tgtggtatggctgattatgatcagtt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMichael Lerman, NCI-Frederick
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 13390-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 13390-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-wtVHL was a gift from Lucy Anderson (Addgene plasmid # 13390 ; http://n2t.net/addgene:13390 ; RRID:Addgene_13390) -
For your References section:
The von Hippel-Lindau tumor suppressor targets to mitochondria. Shiao YH, Resau JH, Nagashima K, Anderson LM, Ramakrishna G. Cancer Res. 2000 Jun 1. 60(11):2816-9. PubMed 10850420