Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-N1-wtVHL
(Plasmid #13389)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 13389 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4695
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    von Hippel-Lindau
  • Alt name
    VHL
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    572
  • GenBank ID
    NM_052801
  • Entrez Gene
    Vhl (a.k.a. Vhlh)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer cggactcagatctcgagctcaa
  • 3′ sequencing primer cgctgaacttgtggccgttt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Michael Lerman, NCI-Frederick

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note, EGFP is not fused to insert.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-wtVHL was a gift from Lucy Anderson (Addgene plasmid # 13389 ; http://n2t.net/addgene:13389 ; RRID:Addgene_13389)
  • For your References section:

    The von Hippel-Lindau tumor suppressor targets to mitochondria. Shiao YH, Resau JH, Nagashima K, Anderson LM, Ramakrishna G. Cancer Res. 2000 Jun 1. 60(11):2816-9. PubMed 10850420