1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 13390: pEGFP-C1-wtVHL
  • von Hippel-Lindau

  • VHL

  • 572

  • R. norvegicus (rat)

  • NM_052801

  • Vhl (Vhlh)

  • GFP

  • N terminal on backbone

  • pEGFP-C1
    (Search Vector Database)

  • Clontech

  • Mammalian Expression

  • 4693

  • HindIII

  • No

  • BamHI

  • No

  • tctcgagctcaagcttcgg List of Sequencing Primers

  • tgtggtatggctgattatgatcagtt

  • Kanamycin

  • DH5alpha

  • 37

  • Unknown

  • Gentamicin

  • Michael Lerman, NCI-Frederick

  • View sequences (2)
  • Lucy Anderson

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The von Hippel-Lindau tumor suppressor targets to mitochondria. Shiao et al (Cancer Res. 2000 Jun 1. 60(11):2816-9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 13390" in your Materials and Methods section.