Skip to main content

pGL3Basic-miR126-EGFL7-Promoter
(Plasmid #32244)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32244 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 32244-D50 50 μg of DNA in Tris buffer $495
DNA 32244-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL3Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miR-126 Promoter 5' UTR
  • Alt name
    EGFL7 Promoter 5' UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1770
  • Mutation
    Promoter region 5' UTR
  • Entrez Gene
    MIR126 (a.k.a. MIRN126, miRNA126, mir-126)
  • Entrez Gene
    EGFL7 (a.k.a. NEU1, VE-STATIN, ZNEU1)
  • Promoter 5' UTR

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCCTGCTGCCAACTTGTTCT
  • 3′ sequencing primer ATGGACCCTAGCCCTTGCTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3Basic-miR126-EGFL7-Promoter was a gift from Charles Lowenstein (Addgene plasmid # 32244 ; http://n2t.net/addgene:32244 ; RRID:Addgene_32244)
  • For your References section:

    Ets-1 and Ets-2 regulate the expression of microRNA-126 in endothelial cells. Harris TA, Yamakuchi M, Kondo M, Oettgen P, Lowenstein CJ. Arterioscler Thromb Vasc Biol. 2010 Oct;30(10):1990-7. Epub 2010 Jul 29. 10.1161/ATVBAHA.110.211706 PubMed 20671229