Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAN-PBAD-sgRNA-A4NT
(Plasmid #62261)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62261 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    unknown
  • Total vector size (bp) 3837
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    A4NT sgRNA
  • gRNA/shRNA sequence
    ataataccagctagttgtgggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt
  • Species
    Synthetic
  • Promoter pBAD

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAN-PBAD-sgRNA-A4NT was a gift from Christopher Voigt (Addgene plasmid # 62261 ; http://n2t.net/addgene:62261 ; RRID:Addgene_62261)
  • For your References section:

    Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Nielsen AA, Voigt CA. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. PubMed 25422271