pHU6_chr12_FAM19A2-up-gRNA-rev
(Plasmid
#81220)
-
PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the upstream region of FAM19A2 locus
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81220 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 81220-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 81220-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepHU6
- Backbone size w/o insert (bp) 2200
- Total vector size (bp) 2200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehU6 expression of gRNA
-
gRNA/shRNA sequenceCh12 psuedo gix site at FAM19A2 locus, 62098362
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAAAAAAGCACCGACTCGGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 81220-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 81220-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHU6_chr12_FAM19A2-up-gRNA-rev was a gift from David Liu (Addgene plasmid # 81220 ; http://n2t.net/addgene:81220 ; RRID:Addgene_81220) -
For your References section:
A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Chaikind B, Bessen JL, Thompson DB, Hu JH, Liu DR. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. 10.1093/nar/gkw707 PubMed 27515511