pcDNA5-FRT/TO-eGFP-msMMS22L
(Plasmid
#221014)
-
Purposemammalian expression vector of eGFP tagged mouse MMS22L
-
Depositing Lab
-
Depositing OrganizationSinai Health System
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221014 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 221014-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 221014-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA5 eGFP-FRT-T0
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 5825
- Total vector size (bp) 9539
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMMS22L
-
Alt nameC16orf167
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3714
-
Mutationnaturally siResistant to siMMS22L (human) aagacuugcuguugcgaua
-
Entrez GeneMms22l (a.k.a. F730047E07Rik, Gm134)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 221014-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 221014-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-FRT/TO-eGFP-msMMS22L was a gift from Daniel Durocher (Addgene plasmid # 221014 ; http://n2t.net/addgene:221014 ; RRID:Addgene_221014) -
For your References section:
The MMS22L-TONSL complex mediates recovery from replication stress and homologous recombination. O'Donnell L, Panier S, Wildenhain J, Tkach JM, Al-Hakim A, Landry MC, Escribano-Diaz C, Szilard RK, Young JT, Munro M, Canny MD, Kolas NK, Zhang W, Harding SM, Ylanko J, Mendez M, Mullin M, Sun T, Habermann B, Datti A, Bristow RG, Gingras AC, Tyers MD, Brown GW, Durocher D. Mol Cell. 2010 Nov 24;40(4):619-31. doi: 10.1016/j.molcel.2010.10.024. Epub 2010 Nov 4. 10.1016/j.molcel.2010.10.024 PubMed 21055983
Map uploaded by the depositor.
