This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pFB-CT10HF-LIC
(Plasmid #39191)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 39191 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFB-CT10HF-LIC
  • Backbone manufacturer
    SGC
  • Vector type
    Baculovirus
  • Tag / Fusion Protein
    • TEV-His-FLAG (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Mach1
  • Growth instructions
    Transform purified plasmid in DH10Bac to generate recombinant bacmid DNA
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    none
  • Promoter polyhedrin

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer fBac-1 (5'-TATTCATACCGTCCCACCA-3')
  • 3′ sequencing primer fBac-2 (5'-GGGAGGTTTTTTAAAGCAAGTAAA-3')
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: GATTGGAAGTAGAGGTTCTCTGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB-CT10HF-LIC was a gift from Nicola Burgess-Brown (Addgene plasmid # 39191)