This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

sgRNA1_GAL4UAS-Luciferase reporter
(Plasmid #64157)


Item Catalog # Description Quantity Price (USD)
Plasmid 64157 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Stanley Qi, Addgene plasmid 44248
  • Total vector size (bp) 8309
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    sgRNA1 for GAL4UAS-Luciferase reporter
  • gRNA/shRNA sequence
  • Species
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstX1 (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AAGGAAACTCACCCTAACTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA1_GAL4UAS-Luciferase reporter was a gift from Moritoshi Sato (Addgene plasmid # 64157)
  • For your References section:

    CRISPR-Cas9-based Photoactivatable Transcription System. Nihongaki Y, Yamamoto S, Kawano F, Suzuki H, Sato M. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. 10.1016/j.chembiol.2014.12.011 PubMed 25619936