Skip to main content

LSB-hsa-miR-409-3p
(Plasmid #103511)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 103511 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    Low Sensor Backbone (LSB)
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hsa-miR-409-3p target
  • Species
    H. sapiens (human)
  • Entrez Gene
    MIR382 (a.k.a. MIRN382, hsa-mir-382, mir-382)
  • Promoter EF-1a

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LSB-hsa-miR-409-3p was a gift from Ron Weiss (Addgene plasmid # 103511 ; http://n2t.net/addgene:103511 ; RRID:Addgene_103511)
  • For your References section:

    A mixed antagonistic/synergistic miRNA repression model enables accurate predictions of multi-input miRNA sensor activity. Gam JJ, Babb J, Weiss R. Nat Commun. 2018 Jun 22;9(1):2430. doi: 10.1038/s41467-018-04575-0. 10.1038/s41467-018-04575-0 PubMed 29934631