Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Why Use Addgene?


Deposit your plasmids with Addgene and we will handle storage, distribution, and record-keeping.

Learn more


Request plasmids and ready-to-use viral preparations from our collection.

Learn more


Learn something new from our science guides, eBooks, videos, and blog.

Learn more




Shipped To

Addgene's Blog

A Better Way to Share Science

Read Blog

Plasmid of the Day


Depositor: Anthony Leung

Purpose: UPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)

Virus of the Day


Depositor: Loren Looger

Purpose: Ready-to-use AAV1 particles produced from pAAV.hSynapsin.SF-iGluSnFR.A184S (#106174). hSynapsin driven SF-iGluSnFR.A184S, glutamate sensor. The A184S mutant has a higher glutamate affinity. These AAV preparations are suitable purity for injection into animals.

Scientists Love Addgene

Addgene has been an exceptionally useful resource for us, both because they can be trusted to supply our plasmids to other labs efficiently, and because we ourselves are constantly ordering reagents of interest that other labs have deposited. Keep up the good work!

Dr. Anjana Rao La Jolla Institute for Immunology
(La Jolla, CA)

Our optogenetic tools are sweeping throughout neuroscience, helping scientists figure out how the brain works. Without Addgene helping provide these to the world, neuroscience would be moving at a much slower pace.

Dr. Ed Boyden Massachusetts Institute of Technology
(Cambridge, MA)

Know of a great plasmid tool
that's not in our collection?

Let us know so we can continue to add useful resources to the repository!

Suggest a Plasmid