Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

viral vector icon   Adeno-associated Virus (AAV) Plasmids

Adeno-associated viruses (AAV) are small viruses originally discovered as contaminants of adenovirus stocks. One major advantage of using AAV for research is that it is replication-limited and typically not known to cause disease in humans. For these reasons, AAVs are generally contained at lower biosafety levels and elicit relatively low immunological effects in vivo. While AAVs can be handled at BSL-1, AAVs expressing oncogenes or toxins should be handled at BSL-2.

AAV can transduce both dividing and non-dividing cells with a low immune response and low toxicity. Although recombinant AAV does not integrate into the host genome, transgene expression can be long-lived. The utility of AAV is currently limited by its small packaging capacity (∼4.5 kb including ITRs), though there is a great deal of interest and effort directed toward expanding this capacity.

Traditionally, AAV requires the presence of another "helper" virus, such as adenovirus or herpes virus, in order to propagate. This is due to the reliance of the AAV on certain exogenous gene products that mediate AAV replication. This requirement has been circumvented with “helper-virus free systems,” which enable the production of infectious AAV particles without the use of a helper virus. Instead, specific gene products can be provided by helper plasmids (e.g., pHelper) and specific packaging cell lines (e.g., HEK293 cells) during AAV production.

Read our AAV Guide for more information about:

  • AAV components
  • Common uses of AAV
  • Viral integration
  • AAV serotypes
  • Pseudotyping

viral-packaging-services-from-addgene Ready-to-use viral preparations for select plasmids are now available through Addgene. Visit our viral service page to learn more about our viral service, and see which plasmids are available as viral preparations.

AAV Plasmids

This table contains a general list of plasmids that are useful in the production of AAV. Many of these plasmids encode the AAV genome (i.e., the genetic information that will be contained in the virion) and/or can be used to generate infectious AAV particles. Additional helper plasmids (which may not be available at Addgene) may be required to produce infectious AAV particles. You can search or sort this table based on plasmid name, species, gene name, and more.

Plasmid Gene/Insert Vector Type Backbone Mutations Tags PI
pAAV-Syn-AlstR-IRES2-EGFPAlstR (Drosophila melanogaster)Mammalian Expression, AAVpAAV-Syn-IRES2-EGFP Callaway
pAAV-Hyg-FHITFHIT Hyg targeting (Homo sapiens)Mammalian Expression, AAV ; adeno-associated viralpAAV-MCS Vogelstein
pAAV-Neo-PTENPTEN Neo targeting (Homo sapiens)Mammalian Expression, AAV ; adeno-associated viralpAAV-MCS Vogelstein
AAV-FLEX-rev-ChR2-tdtomatoChannelrhodopsin 2-tdtomatoAAV, Cre/Lox ; Adeno-Associated VirusAAV2tdtomato Sternson
pACAGW-ChR2-Venus-AAVChannelrhodopsin-2Mammalian Expression, AAVN/AVenus Svoboda
pAAV-EF1a-double floxed-EYFP-WPRE-HGHpAEYFPMammalian Expression, AAVpAAV Deisseroth
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpAchannelrhodopsin-2Mammalian Expression, AAVpAAV humanized ChR2 gene with histidine 134 changed to arginine, to achieve higher currents mCherry Deisseroth
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpAchannelrhodopsin-2Mammalian Expression, AAVpAAV humanized ChR2 gene with histidine 134 changed to arginine, to achieve higher currents EYFP Deisseroth
pAAV-EF1a-double floxed-mCherry-WPRE-HGHpAmCherryMammalian Expression, AAVpAAV Deisseroth
pAAV-double floxed-eNpHR-EYFP-WPRE-pAhalorhodopsinMammalian Expression, AAVpAAVEYFP Deisseroth
sc AAV miR26a eGFPEF1 alpha -miR26a GFP p(A)Mammalian Expression, AAV ; scpEMBL N/A GFP Mendell
AAV-FLEX-Arch-GFPArchMammalian Expression, AAV, Cre/Lox ; adeno-associated virusAAV-FLEX no GFP Boyden
pAAV-hSyn-RFPhuman Synapsin I promoter driving DsRedExpress (Homo sapiens)Mammalian Expression, AAV ; Adeno-associated viruspAAV Callaway
pAAV-mCAMK-RFPmouse alpha-calcium/calmodulin-dependent protein kinase II promoter (Mus musculus)Mammalian Expression, AAVpAAV Callaway
pAAV-CAG-RFPChicken Beta-actin promoter driving DsRedExpressMammalian Expression, AAV ; Adeno-associated viruspAAV Callaway
pAAV-fCR-GFPfugu calretinin promoter driving GFPMammalian Expression, AAVpAAV Callaway
pAAV-fNPY-GFPfugu neuropeptide Y promoter driving GFPMammalian Expression, AAVpAAV Callaway
pAAV-fSST-RFPfugu somatostatin promoter driving DsRed 2Mammalian Expression, AAVpAAV Callaway
pAAV-fPV-GFPfugu parvalbumin promoter driving GFPMammalian Expression, AAVpAAV Callaway
pAAV-fSFRP2-GFPfugu secreted frizzled receptor protein 2 promoter driving GFPMammalian Expression, AAVpAAV Callaway
pAAV-fTCAP-GFPfugu titan cap promoter driving GFPMammalian Expression, AAVpAAV Callaway
pAAV-fCAMK-GFPfugu α-calcium/calmodulin-dependent protein kinase II promoter driving GFPMammalian Expression, AAVpAAV Callaway
pAAV-mA93-RFPmouse riken gene A930038C07Rik promoter driving DsRedExpress (Mus musculus)Mammalian Expression, AAVpAAV Callaway
pAAV-hPDGFRA-GFPhuman platelet derived growth factor receptor alpha polypeptide promoter driving GFP (Homo sapiens)Mammalian Expression, AAVpAAV Callaway
pAAV-hGRM1-RFPhuman receptor metabotropic 1 promoter driving DsRedExpress (Homo sapiens)Mammalian Expression, AAVpAAV Callaway
pAAV-hNPPC-RFPhuman c-type natruiretic peptide precursor promoter driving DsRedExpress (Homo sapiens)Mammalian Expression, AAVpAAV Callaway
pAAV-hADM-RFPhuman adrenomedullin promoter driving DsRedExpress (Homo sapiens)Mammalian Expression, AAVpAAV Callaway
pAAV-hST3GAL6-RFPhuman type 2 lactosamine alpha-2,3-sialyltransferase promoter driving DsRedExpress (Homo sapiens)Mammalian Expression, AAVpAAV Callaway
pAAV-hRREB1-RFPhuman ras responsive element binding protein 1 driving DsRedExpress (Homo sapiens)Mammalian Expression, AAVpAAV Callaway
pAAV-hNR2F2-RFPhuman nuclear receptor subfamily 2 group F member 2 promoter driving DsRedExpress (Homo sapiens)Mammalian Expression, AAVpAAV Callaway
pAAV-DR1-NRSE-RFPperoxisome proliferator activated receptor gamma binding site promoter with neuron-restrictive silencer element with minimal CMVMammalian Expression, AAVpAAV Callaway
pAAV-E1.1-RFPE1.1 binding site from Scardigli et al., 2003 with minimal CMVMammalian Expression, AAVpAAV Callaway
pAAV-E1.1-NRSE-RFPE1.1 binding site from Scardigli et al. 2003, with neuron-restrictive silencing element, with minimal CMVMammalian Expression, AAVpAAV Callaway
AAV-pgk-CreCre recombinase (codon optimized)AAV, Cre/Lox ; Adeno-associatedpAAV-pgk-MCS Aebischer
pAAV-SEPT-Acceptor0Mammalian Expression, AAVpAAV (Strategene) Waldman
pAAV-TK-Acceptor0Mammalian Expression, AAVpAAV (Strategene) Waldman
pAAV-FLEX-hGTBTet transactivator, enhanced green fluorescent protein, TVA, rabies B19 glycoprotein (Homo sapiens)AAV, Cre/Lox ; Adeno-associated viruspAAV F2A has 2A cleavage site deleted, producing htTA-eGFP fusion. tTA, TVA, and B19G are all mammalian codon optimized Callaway
pAAV-EF1a-FLEX-GTBEnhanced green fluorescent protein, TVA, rabies B19 glycoprotein (Mus musculus)AAV, Cre/Lox ; Adeno-associated viruspAAV-double floxed-EYFP-WPRE-pA TVA, rabies glycoprotein are mammalian codon optimized Callaway
pAAV-EF1a-FLEX-GTEnhanced green fluorescent protein, TVA (Mus musculus)AAV, Cre/LoxpAAV-double floxed-EYFP-WPRE-pA TVA mammalian codon optimized Callaway
AAV-CAG-ChR2-GFPChR2Mammalian Expression, AAV ; adeno-associated virusAAV with CAG promoterGFP Boyden
pAAV-Ef1a-DIO eNpHR 3.0-EYFPeNpHR 3.0 (Homo sapiens)Mammalian Expression, AAVpAAV ER export at 3' end of gene. Trafficking signal (TS) in between gene and fluorophore. EYFP Deisseroth
pAAV-Ef1a-DIO ChETA-EYFPhChR2(E123T/H134R)-EYFP (Homo sapiens)Mammalian Expression, AAVpAAV E123T, H134R EYFP Deisseroth
pAAV-CaMKIIa-hChR2(H134R)-EYFPhChR2(H134R) (Homo sapiens)Mammalian Expression, AAVpAAV Histidine 134 is mutated to Arginine EYFP Deisseroth
pAAV-CaMKIIa-eNpHR 3.0-EYFPeNpHR 3.0 (Homo sapiens)Mammalian Expression, AAVpAAV Trafficking Signal (TS) ER Export Signal EYFP Deisseroth
pAAV-hSyn-eNpHR 3.0-EYFPeNpHR 3.0 (Homo sapiens)Mammalian Expression, AAVpAAV Trafficking Signal (TS) ER Export Signal EYFP Deisseroth
pAAV-hSyn-hChR2(H134R)-EYFPhChR2(H134R) (Homo sapiens)Mammalian Expression, AAVpAAV H134R EYFP Deisseroth
pAAV-CaMKIIa-hChR2(H134R)-mCherryhChR2(H134R) (Homo sapiens)Mammalian Expression, AAVpAAV H134R mCherry Deisseroth
pAAV-hSyn-hChR2(H134R)-mCherryhChR2(H134R) (Homo sapiens)Mammalian Expression, AAVpAAV H134R mCherry Deisseroth
pAAV-GFAP-hChR2(H134R)-EYFPhChR2(H134R) (Homo sapiens)Mammalian Expression, AAVpAAV H134R EYFP Deisseroth
pAAV-GFAP-hChR2(H134R)-mCherryhChR2(H134R) (Homo sapiens)Mammalian Expression, AAVpAAV H134R mCherry Deisseroth
pAAV-Ef1a-DIO EYFPEYFP (Homo sapiens)Mammalian Expression, AAVpAAV Deisseroth
pAAV-TRE-HTGhistone-GFP-2A-TVA receptor-2A-rabies glycoproteinAAV ; adeno-associated viralpAAV2-MCS N/A Luo
pAAV-minCMV-mCherrymCherry (Synthetic)Mammalian Expression, AAVpAAV Zhang
AAV-CAG-GFPeGFPAAV ; adeno associate viralAAV2/1 Svoboda
AAV-CAG-hChR2_tdTomatohumanized ChR2-tdTomatoAAV ; adeno associate viralAAV2/1tdTomato Svoboda
AAV-CAG-hChR2-H134R-tdTomatohumanized ChR2-H134R-tdTomatoAAV ; adeno associate viralAAV2/1 H134R tdTomato Svoboda
pAAV-FLEX-GFPGFPMammalian Expression, AAV, Cre/Lox ; Adeno-associated virusAAV-FLEX N/A Boyden
pAAV-FLEX-ArchT-tdTomatoArchT-tdTomatoMammalian Expression, AAV, Cre/Lox ; Adeno-associated virusAAV-FLEX N/A tdTomato Boyden
pAAV-FLEX-tdTomatotdTomatoMammalian Expression, AAV, Cre/Lox ; Adeno-associated virusAAV-FLEX N/A Boyden
pAAV-FLEX-ArchT-GFPArchT-GFPMammalian Expression, AAV, Cre/Lox ; Adeno-associated virusAAV-FLEX N/A GFP Boyden
pAAV-CAG-ArchT-GFPArchT-GFPMammalian Expression, AAV ; Adeno-associated virusAAV with CAG promoter N/A GFP Boyden
pAAV-CAG-ArchT-tdTomatoArchT-tdTomatoMammalian Expression, AAV ; Adeno-associated virusAAV with CAG promoter N/A tdTomato Boyden
AAV-Flex-rev-oChIEF-tdTomatooChIEF-tdtomatoAAV, Cre/LoxAAV-FLEX-rev-ChR2-tdtomatotdTomato McQuiston
AAV-6P-SEW-YC3.6Yellow Cameleon 3.60AAVAAV-6P-SEWBeCFP, Venus Helmchen
pAAV-GFPGFPMammalian Expression, AAV ; Adeno-Associated ViruspSub201 Gray
pscAAV-GFPGFPMammalian Expression, AAV ; Adeno-Associated ViruspSub201 Gray
rAAV-syn::FLEX-rev::PSAMQ79G,Q139G:5HT3HC-IRES-GFPPSAMQ79G,Q139G-5HT3HC (Homo sapiens)AAV, Cre/Lox ; Adeno-associated virus, FLEX switchAAV2IRES-EGFP Sternson
rAAV-syn::FLEX-rev::PSAML141F,Y115F:5HT3HC-IRES-GFPPSAML141F,Y115F-5HT3HC (Homo sapiens)AAV, Cre/Lox ; Adeno-associated virus, FLEX switchAAV2IRES-EGFP Sternson
rAAV-syn::FLEX-rev::PSAML141F:GlyR-IRES-GFPPSAML141F-GlyR-IRES-GFP (Homo sapiens)AAV, Cre/Lox ; Adeno-associated virus, FLEX switchAAV2IRES-EGFP Sternson
rAAV-syn::FLEX-rev::PSAML141F,Y115F:GlyR-IRES-GFPPSAML141F,Y115F-GlyR (Homo sapiens)AAV, Cre/Lox ; Adeno-associated virus, FLEX switchAAV2IRES-EGFP Sternson
rAAV-CAG::FLEX-rev:ChR2HA:2a:PSAML141F,Y115F:GlyRChR2HA-2a-PSAML141F,Y115F:GlyR (Homo sapiens)AAV, Cre/Lox ; Adeno-associated virus, FLEX switchAAV2ChR2 2A Sternson
pAAV-GatewayAAV ; aavpACAGW-ChR2-Venus-AAV Nolan
pACAGW-oChiEFtdTomato-AAVoChiEFAAVpACAGW-ChR2-Venus-AAVtdTomato McQuiston
pACAGW-H2B-PAGFP-AAVH2B-PAGFP (Homo sapiens)Mammalian Expression, AAV ; adeno associated virusN/APAGFP Scanziani
paavCAG-pre-mGRASP-mCeruleanpresynaptic mGRASP (Mus musculus)AAVpaavCAG Kim
paavCAG-pre-mGRASP-mCerulean-2A-nls-mCherrypresynaptic mGRASP (Mus musculus)AAVpaavCAG Kim
paavCAG-post-mGRASP-2A-dTomatopostsynaptic mGRASP (Mus musculus)AAVpaavCAG Kim
paavCAG-Jx-rev-post-mGRASP-2A-dTomatopostsynaptic mGRASP (Mus musculus)AAV, Cre/LoxpaavCAG Kim
pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFPChR1-VChR1 Chimera (Synthetic)Mammalian Expression, AAVpAAV E122T and E162T EYFP Deisseroth
pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherryChR1-VChR1 Chimera (Synthetic)Mammalian Expression, AAVpAAV E122T and E162T mCherry Deisseroth
pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFPChR1-VChR1 Chimera (Synthetic)Mammalian Expression, AAVpAAV E122T and E162T EYFP Deisseroth
pAAV-CaMKIIa-C1V1 (t/t)-TS-mCherryChR1-VChR1 Chimera (Synthetic)Mammalian Expression, AAVpAAV E122T and E162T mCherry Deisseroth
pAAV-CaMKIIa-hChR2(C128S/D156A)-EYFPhChR2Mammalian Expression, AAVpAAV C128S and D156A EYFP Deisseroth
pAAV-CaMKIIa-hChR2(C128S/D156A)-mCherryhChR2(C128S/D156A)-mCherryMammalian Expression, AAVpAAV C128S and D156A mCherry Deisseroth
pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFPhChR2(C128S/D156A)-EYFPMammalian Expression, AAVpAAV C128S and D156A EYFP Deisseroth
pAAV-Ef1a-DIO hChR2(C128S/D156A)-mCherryhChR2(C128S/D156A)-mCherryMammalian Expression, AAVpAAV C128S and D156A mCherry Deisseroth
pAAV-CaMKIIa-hChR2(E123A)-EYFPhChR2Mammalian Expression, AAVpAAV E123A EYFP Deisseroth
pAAV-CaMKIIa-hChR2(E123A)-mCherryhChR2Mammalian Expression, AAVpAAV E123A mCherry Deisseroth
pAAV-Ef1a-DIO hChR2(E123A)-EYFPhChR2Mammalian Expression, AAVpAAV E123A EYFP Deisseroth
pAAV-Ef1a-DIO hChR2(E123A)-mCherryhChR2Mammalian Expression, AAVpAAV E123A mCherry Deisseroth
pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFPhChR2Mammalian Expression, AAVpAAV E123T and T159C EYFP Deisseroth
pAAV-Ef1a-DIO hChR2(E123T/T159C)-mCherryhChR2Mammalian Expression, AAVpAAV E123T and T159C mCherry Deisseroth
pAAV-CaMKIIa-hChR2(E123T/T159C)-EYFPhChR2Mammalian Expression, AAVpAAV E123T and T159C EYFP Deisseroth
pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherryhChR2Mammalian Expression, AAVpAAV E123T and T159C mCherry Deisseroth
pLenti-CaMKIIa-eArchT 3.0-EYFPeArchT 3.0-EYFPMammalian Expression, LentiviralpLenti Enhanced trafficking signal and ER export signal added EYFP Deisseroth
pAAV-CaMKIIa-eArch 3.0-EYFPArch3.0-EYFPMammalian Expression, AAVpAAV Enhanced trafficking signal and ER export signal added EYFP Deisseroth
pAAV-Ptet-RFP-shR-rtTAMammalian Expression, AAV, RNAi ; Tet induciblepAAV with pTRIPZ elements Gu
pAAVf-EnhCB-lacZnlsAAVpBS Zamore
pAAVf-EnhCB-lacZnls mir-122 1xBS1 miR-122 target site (Synthetic)AAVpAAVf-EnhCB-lacZnls Zamore
pAAVf-EnhCB-lacZnls miR-122 3x3 miR-122 target sites (Synthetic)AAVpAAVf-EnhCB-lacZnls Zamore
pAAVscCBPIGplucAAVpAAVscCBPIGpluc Zamore
pAAVsc CB6PI Gpluc7XmiR-122T7 bulged miR-122 target sites (Synthetic)AAVpAAVscCBPIGpluc Zamore
pAAVscCBPI TuDmiR122Gpluc7xlet7BTTuD miR-122 (Synthetic)AAVpAAVscCBPIGpluc7xlet-7BT Zamore
pAAVscCBPITuD122Gpluc7x122BTTuD miR-122 (Synthetic)AAVpAAVscCBPIGpluc7xmiR-122BT Zamore
pAAVscCBPITuDlet-7Gpluc7x122BTTuD let-7 (Synthetic)AAVpAAVsc CB6PI Gpluc7XmiR-122BT Zamore
pAAVscCBPITuDlet-7Gpluc7xlet7BTTuD let-7 (Synthetic)AAVpAAVscCBPIGpluc7xlet-7BT Zamore
pAAVscCBPITuDlet-7GplucTuD let-7 (Synthetic)AAVpAAVscCBPIGpluc Zamore
pAAVscCBPTuDmiR122 GplucTuD miR-122 (Synthetic)AAVpAAVscCBPIGpluc Zamore
pAAV CB6 FFLuc-miR122pri-miR-122AAVpENN AAV CB6 FFLuc Zamore
pAAV TBG FFluc miR122spongemiR-122 sponge (Synthetic)AAVpAAV TBG FFluc Zamore
pAAV TBG FFLucMammalian Expression, AAVpBS Zamore
pAAV asyn WTalpha-synuclein WT (Homo sapiens)Mammalian Expression, AAVpAAV-MCS Lashuel
pAAV asyn S87Aalpha-synuclein S87A (Homo sapiens)Mammalian Expression, AAVpAAV-MCS S87A Lashuel
pAAV asyn S87Ealpha-synuclein S87E (Homo sapiens)Mammalian Expression, AAVpAAV-MCS S87E Lashuel
pAAV asyn S129Aalpha-synuclein S129A (Homo sapiens)Mammalian Expression, AAVpAAV-MCS S129A Aebischer
pAAV asyn S129Galpha-synuclein S129G (Homo sapiens)Mammalian Expression, AAVpAAV-MCS S129G Lashuel
pAAV asyn S129Ealpha-synuclein S129E (Homo sapiens)Mammalian Expression, AAVpAAV-MCS S129E Lashuel
pAAV asyn S129Dalpha-synuclein S129D (Homo sapiens)Mammalian Expression, AAVpAAV-MCS S129D Aebischer
pAAV asyn S87A/S129Aalpha-synuclein S87A/S129A (Homo sapiens)Mammalian Expression, AAVpAAV-MCS S87A/S129A Aebischer
pAAV asyn S87D/S129Aalpha-synuclein S87D/S129A (Homo sapiens)Mammalian Expression, AAVpAAV-MCS S87D/S129A Aebischer
pAAV-Ef1a-DO-hChR2(H134R)-mCherry-WPRE-pAhChr2(H134R)-mCherry (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pAmCherry Sabatini
pAAV-Ef1a-DIO-mCherry-WPRE-pAmCherry (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA Sabatini
pAAV-Ef1a-DIO-EGFP-WPRE-pAEGFP (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA Sabatini
pAAV-Ef1a-DO-EGFP-WPRE-pAEGFP (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA Sabatini
pAAV-Ef1a-DO-ChETA-EYFP-WPRE-pAChETA-YFP (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pAEYFP Sabatini
pAAV-Ef1a-DO-NpHR3.0-eYFP-WPRE-pANpHR3.0-EYFP (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pAEYFP Sabatini
pAAV-Ef1a-FAS-NpHR3.0-eYFP-WPRE-pANpHR3.0-EYFP (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pAEYFP Sabatini
pAAV-Ef1a-FAS-ChETA-TdTomato-WPRE-pAChETA-TdTomato (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pATdTomato Sabatini
pAAV-Ef1a-FAS-hChR2(H134R)-mCherry-WPRE-pAhChr2(H134R)-mCherry (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pAmCherry Sabatini
pAAV-Ef1a-FAS-EGFP-WPRE-pAd1eGFP (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA Sabatini
pAAV-Ef1a-FAS-TdTomato-WPRE-pATdTomato (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA Sabatini
pAAV-Ef1a-DO-mCherry-WPRE-pAmCherry (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA Sabatini
pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pATdTomato-EGFP (Synthetic)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA Sabatini
pAAV-EF1a-DIO-HBHistone, 2A element, rabies B19 glycoproteinAdeno-associated vectorAAVGFP Callaway
pAAV-Ef1a-DIO-ChETA-TdTomato-WPRE-pAChETA-TdTomato (Synthetic)rAAVpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pATdTomato Sabatini
pAAV-Ef1a-DO-ChETA-TdTomato-WPRE-pAChETA-TdTomato (Synthetic)rAAVpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pATdTomato Sabatini
pAAV-CamKII-ArchT-GFPArchT-GFPMammalian Expression, AAV ; Adeno-associated virusAAV with CaMKII promoter N/A GFP Boyden
pAAV-CAG-Arch-GFPArchMammalian Expression, AAV ; Adeno-associated virusAAV with CAG promoter N/A GFP Boyden
pAAV-CAG-GFPGFPMammalian Expression, AAV ; Adeno-associated virusAAV with CAG promoter N/A Boyden
pAAV-CA-FLEXMammalian Expression, AAV, Cre/LoxpAAV Uchida
pAAV-CA-FLEX-RGRabies virus glycoproteinMammalian Expression, AAV, Cre/LoxpAAV-CA-FLEX Uchida
pAAV-EF1a-FLEX-TVA-mCherryAvian sarcoma and leukemia virus receptor 950 (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAVmCherry Uchida
pAAV-Ef1a-DIO-VGAT-WPRE-pASlc32a1 (Mus musculus)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA Sabatini
pAAV-Ef1a-DIO-VMAT2-WPRE-pASlc18a2 (Mus musculus)AAV ; rpAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA Myc tag inserted in the first lumenal loop between Glycines 98 and 99 Sabatini
pAAV-EF1a-HA-hTet1CD-WPRE-PolyAHA-hTet1CD (Homo sapiens)Mammalian Expression, AAVpAAV aa1418–2136 HA Song
pAAV-EF1a-HA-hTet1CDmu-WPRE-PolyAHA-hTet1CDmu (Homo sapiens)Mammalian Expression, AAVpAAV aa1418–2136 with mutations H1672 to Y, 1674D to A HA Song
pAAV_TALE-TF(VP64)-BB_V3TALE-TF(VP64)-BBMammalian Expression, AAV ; Adeno-associated Virus ()pAAV3XFlag Zhang
pAAV_TALEN-FokI(WT)-BB_V3TALEN-FokI(WT)-BBMammalian Expression, AAV ; Adeno-associated Virus ()pAAV3XFlag Zhang
pAAV-EF1a-DIO-HTBHistone tagged GFP, T2A-TVA-E2A-B19GAAV ; Adeno-associated vectorpAAVGFP Callaway
pZac2.1 gfaABC1D-Lck-GCaMP3Lck-GCaMP3Mammalian Expression, AAV ; Adeno-Associated Virus ()pZac 2.1 Khakh
pZac2.1 gfaABC1D-Cyto-GCaMP3GCaMP3Mammalian Expression, AAV ; Adeno-Associated Virus ()pZac 2.1 Khakh
pZac2.1 gfaABC1D-tdTomatotdTomatoMammalian Expression, AAV ; Adeno-Associated Virus ()pZac 2.1 Khakh
pAAV-hSyn-DIO-hM3D(Gq)-mCherryhM3D(Gq)-mCherry (Homo sapiens)AAV ; Adeno Associated Viral VectorpAAVmCherry Roth
pAAV-hSyn-DIO-hM4D(Gi)-mCherryhM4D(Gi)-mCherry (Homo sapiens)AAV ; Adeno Associated Viral VectorpAAVmCherry Roth
AAV-EF1a-BbTagBYpAAV-EF1a-Brainbow-invert tagBFP-EYFP-WPREMammalian Expression, AAV ; adeno-associated viralpAAV-EF1a-WPRE Sanes
AAV-EF1a-BbChTpAAV-Ef1a-Brainbow/mCherry/mTFP-WPREMammalian Expression, AAV ; adeno-associated viralpAAV-EF1a-WPRE Sanes
pAAV-flex-taCasp3-TEVpCaspase 3 (Homo sapiens), Tobacco Etch Virus proteaseAAV ; Adeno Associated Viral VectorpAAV-MCS Linker replaced with a TEV protease cleavage site Shah
pAAV-EF1a-YCNano140YCNano140 (Synthetic)Mammalian Expression, AAVpAAV Helmchen
pAAV-Ku70-TCXRCC6 targeting construct (Homo sapiens)AAV ; rpAAV-MCS2GFP-FLAG Jackson
pAAV_hSyn_TALEBB(NN)-NLS-VP64_2A_GFP_WPRE_bGHpATALE BB(N136_0.5NN_C63)-VP64 (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpA2A_GFP Zhang
pAAV_hSyn_TALEBB(HD)-NLS-VP64_2A_GFP_WPRE_bGHpATALE BB(N136_0.5HD_C63)-VP64 (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpA2A_GFP Zhang
pAAV_hSyn_TALEBB(NG)-NLS-VP64_2A_GFP_WPRE_bGHpATALE BB(N136_0.5NG_C63)-VP64 (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpA2A_GFP Zhang
pAAV_hSyn_TALEBB(NI)-NLS-VP64_2A_GFP_WPRE_bGHpATALE BB(N136_0.5NI_C63)-VP64 (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpA2A_GFP Zhang
pAAV_hSyn_TALEBB(NN)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpATALE BB(N136_0.5NN_C63)-SID4X (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpA2A_phiLOV2.1 Zhang
pAAV_hSyn_TALEBB(HD)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpATALE BB(N136_0.5HD_C63)-SID4X (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpA2A_phiLOV2.1 Zhang
pAAV_hSyn_TALEBB(NG)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpATALE BB(N136_0.5NG_C63)-SID4X (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpA2A_phiLOV2.1 Zhang
pAAV_hSyn_TALEBB(NI)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpATALE BB(N136_0.5NI_C63)-SID4X (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpA2A_phiLOV2.1 Zhang
LITE1.0_pAAV_hSyn_TALE(Grm2)-NLS-CIB1_2A_GFP_WPRE_bGHpATALE (N136,Grm2,C63)-cib1 (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpAHA Zhang
LITE1.0_pAAV_hSyn_CRY2PHR-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpACRY2PHR-NLS-SID4X (Synthetic)Mammalian Expression, AAVpAAV_hSyn_WPRE_bGHpA2A_phiLOV2.1 Zhang
LITE2.0 pAAV_hSyn_NLS(alpha-imp)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpANLS(alpha-imp)-CRY2PHR-NLS-VP64 (Synthetic)Mammalian Expression, AAVpAAV_hSyn_WPRE_bGHpA2A_GFP Zhang
LITE2.0_pAAV_hSyn_TALE(Grm2)-GS-CIB1(NLS*,∆318-334)_WPRE_bGHpATALE(Grm2)-GS-CIB1(NLS*,∆318-334) (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpAHA Zhang
pOTTC374 - pAAV EF1a DIO iRFPInfrared fluorescent protein (Other)Mammalian Expression, AAV, Cre/LoxpAAV EF1a DIO Harvey
pOTTC469 - pAAV EF1a DIO eNpHR3.0-iRFPeNpHR3.0Mammalian Expression, AAV, Cre/LoxpAAV EF1a DIOiRFP Harvey
pOTTC468 - pAAV EF1a DIO hChR2(H134R)-iRFPhChR2 (H134R) (Other)Mammalian Expression, AAV, Cre/LoxpAAV EF1a DIO H134R iRFP Harvey
pOTTC337 - pAAV EF1a DIO mCherrymCherry (Other)Mammalian Expression, AAV, Cre/LoxpAAV EF1a DIO Harvey
pOTTC364 - pAAV CaMKIIa iRFPInfrared fluorescent protein (Other)Mammalian Expression, AAVpAAV CaMKII hChR2-EYFP Harvey
pOTTC352 - pAAV CaMKIIa eNpHR3.0-iRFPeNpHR3.0 (Other)Mammalian Expression, AAVpAAV-CaMKIIa-eNpHR 3.0-EYFPiRFP Harvey
pOTTC351 - pAAV CaMKIIa hChR2(H134R)-iRFPhChR2(H134R) (Other)Mammalian Expression, AAVpAAV-CaMKIIa-hChR2(H134R)-EYFP H134R iRFP Harvey
pOTTC475 - pAAV c-fos iRFPInfrared fluorescent protein (Other)Mammalian Expression, AAVpAAV c-fos eYFP Harvey
pOTTC476 - pAAV c-fos eYFPenhanced Yellow Fluorescent Protein (Other)AAVpAAV CaMKIIa hChR2-EYFP Harvey
LITE1.0_pAAV_hSyn_CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpACRY2PHR-NLS-VP64 (Synthetic)Mammalian Expression, AAV ; TALEpAAV_hSyn_WPRE_bGHpA2A_GFP Zhang
CAG-Flex-TC66TTVA receptor mCherry fusion with the 66T mutationMammalian Expression, AAV, Cre/LoxpAAV 66T mCherry fusion to TVA receptor Luo
CAG-Flex-TCBTVA receptor mCherryMammalian Expression, AAVpAAVmCherry fusion to TVA receptor Luo
CAG-Flex-RGRabies GlycoproteinMammalian Expression, AAVpAAV Luo
AAV GFPeGFP (Other)Mammalian Expression, AAVadeno-associated viral (AAVsp) Gage
AAV-GFP/CreCre (Mus musculus)Mammalian Expression, Mouse Targeting, AAV, Cre/Loxadeno-associated viral (AAVsp)Myc, NLS, EGFP Gage
pAAV-FLEX-C-RGCerulean-E2A-RG (Other)Mammalian Expression, AAV, Cre/LoxpAAV-EF1a-FLEX-GTBcerulean Margrie
pEMS1977ssAAV-Ple251-icre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1978ssAAV-Ple251-icre-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1980ssAAV-MCS-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1981ssAAV-Ple264-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1982ssAAV-Ple261-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1983ssAAV-Ple253-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1984ssAAV-Ple253-iCre-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1985ssAAV-Ple155-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1986ssAAV-Ple155-iCre-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1988ssAAV-CAGGS-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1989ssAAV-CAGGS-iCre-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1990ssAAV-Ple67-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1991ssAAV-Ple67-iCre-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1993ssAAV-Ple304-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1994ssAAV-Ple266-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1995ssAAV-Ple94-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1996ssAAV-Ple267-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS1997ssAAV-Ple198-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2021ssAAV-Ple302-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2022ssAAV-PRS2/3:Con-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2023ssAAV-hs1218-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2024ssAAV-hs671-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2025ssAAV-Ple303-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2026ssAAV-Ple301-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2031ssAAV-Ple305-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2050ssAAV-CAGGS-emGFP (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2058ssAAV-CAGGS-emGFP-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2112ssAAV-Ple264-emGFP (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2113ssAAV-Ple67-emGFP-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2114ssAAV-Ple67-emGFP (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2115ssAAV-Ple155-emGFP-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2116ssAAV-Ple155-emGFP (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2117ssAAV-smCBA-iCre (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2118ssAAV-smCBA-iCre-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
AAV-CMV-LOXP-stop-LOXP-mG-CaMP3.0G-CaMP3 (Synthetic)AAVAAVMARCKS sequence (MGCCFSKT) Anderson
AAV phSyn1(S)-DreO-bGHpADreO recombinase (Other)AAVpAAV-MCS Sequence optimized for expression in mammalian cells none Zeng
AAV phSyn1(S)-FlpE-bGHpAFlpE recombinase gene (Saccharomyces cerevisiae)AAVpAAV-MCS Zeng
pAAV-hSyn-DIO-HA-hM3D(Gq)-IRES-mCitrinehM3D(Gq)-IRES-mCitrine (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA Roth
pAAV-hSyn-DIO-HA-hM4D(Gi)-IRES-mCitrinehM4D(Gi)-IRES-mCitrine (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA Roth
pAAV-hSyn-DIO-HA-rM3D(Gs)-IRES-mCitrinerM3D-IRES-mCitrine (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA Roth
pAAV-hSyn-DIO-rM3D(Gs)-mCherryrM3D-mCherry (Rattus norvegicus)AAVpAAV See supplemental documents for DREADD mutations HA, mCherry Roth
pAAV-hSyn-DIO-mCherrymCherry (Other)AAVpAAVN/A Roth
pAAV-EF1a-DIO-hM3D(Gq)-mCherryhM3D(Gq)-mCherry (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA, mCherry Roth
pAAV-EF1a-DIO-hM4D(Gi)-mCherryhM4D(Gi)-mCherry (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA, mCherry Roth
pAAV-EF1a-DIO-mCherrymCherry (Other)AAVpAAVN/A Roth
pAAV-hSyn-HA-hM3D(Gq)-IRES-mCitrinehM3D(Gq)-IRES-mCitrine (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA Roth
pAAV-hSyn-HA-hM4D(Gi)-IRES-mCitrinehM4D(Gi)-IRES-mCitrine (Homo sapiens)AAVpAAVHA Roth
pAAV-CaMKIIa-HA-hM3D(Gq)-IRES-mCitrinehM3D(Gq)-IRES-mCitrine (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA Roth
pAAV-CaMKIIa-HA-hM4D(Gi)-IRES-mCitrinehM4D(Gi)-IRES-mCitrine (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA Roth
pAAV-CaMKIIa-HA-rM3D(Gs)-IRES-mCitrinerM3D-IRES-mCitrineAAVpAAV See supplemental documents for DREADD mutations HA Roth
pAAV-GFAP-HA-hM3D(Gq)-IRES-mCitrinehM3D(Gq)-IRES-mCitrine (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA Roth
pAAV-GFAP-HA-hM4D(Gi)-IRES-mCitrinehM4D(Gi)-IRES-mCitrine (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA Roth
pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrinerM3D-IRES-mCitrine (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations HA Roth
pAAV-hSyn-hM3D(Gq)-mCherryhM3D(Gq)-mCherry (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations mCherry Roth
pAAV-hSyn-hM4D(Gi)-mCherryhM4D(Gi)-mCherryAAVpAAV See supplemental documents for DREADD mutations mCherry Roth
pAAV-CaMKIIa-hM3D(Gq)-mCherryhM3D(Gq)-mCherry (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations mCherry Roth
pAAV-CaMKIIa-hM4D(Gi)-mCherryhM4D(Gi)-mCherry (Homo sapiens)AAVpAAV See supplemental documents for DREADD mutations mCherry Roth
pAAV-GFAP-hM3D(Gq)-mCherryhM3D(Gq)-mCherryAAVpAAV See supplemental documents for DREADD mutations mCherry Roth
pAAV-GFAP-hM4D(Gi)-mCherryhM4D(Gi)-mCherryAAVpAAV See supplemental documents for DREADD mutations mCherry Roth
pOTTC292 - pAAV EF1a floxed hChR2(H134R)-EYFPhChR2 (H134R) (Other)Mammalian Expression, AAV, Cre/LoxAddgene 20298 H134R EYFP Harvey
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pAmRuby2-P2A-GCaMP6s (Rattus norvegicus)AAVpAAV Bonhoeffer
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6f-WPRE-pAmRuby2-P2A-GCaMP6f (Rattus norvegicus)AAVpAAV Bonhoeffer
AAV-ReaChR-citrineReaChR-citrine (Synthetic)AAVAAV2citrine Tsien
AAV-flex-ReaChR-citrineReaChR-citrine (Synthetic)AAVAAV2citrine Tsien
AAV-miniSOG-VAMP2-citrineminiSOG-VAMP2-citrine (Mus musculus)AAVAAV2miniSOG, citrine Tsien
AAV2-miniSOG-VAMP2-T2A-mCherryminiSOG-VAMP2-T2A-mCherry (Mus musculus)AAVAAV2miniSOG, T2A-mCherry Tsien
AAV-SYP1-miniSOG-citrineSynaptophysin-miniSOG-citrine (Rattus norvegicus)AAVAAV2miniSOG, citrine Tsien
AAV-SYP1-miniSOG-T2A-mCherrySynaptophysin-miniSOG-T2A-mCherry (Rattus norvegicus)AAVAAV2miniSOG, T2A-mCherry Tsien
AAV-flex-oChIEF-citrineChIEF-citrine (Synthetic)AAVAAV2 inverted and inserted between two lox sites citrine Tsien
AAV-oChIEF-citrineChIEF-citrine (Synthetic)AAVAAV2 ChIEF gene is mammalian codon optimized citrine Tsien
AAV-oChEF-citrineChEF-citrine (Synthetic)AAVAAV2 ChEF gene is mammalian codon optimized citrine Tsien
AAV-oChD-citrineoChD-citrineAAVAAV2 ChD gene is mammalian codon optimized citrine Tsien
AAV-oChIEF-tdTomatoChIEF-tdTomato (Synthetic)AAVAAV2 ChIEF gene is mammalian codon optimized tdTomato Tsien
AAV-EF1a-DIO-GCaMP6s-P2A-nls-dTomatoGCaMP6s (Synthetic)Mammalian Expression, AAVpAAV-EF1a-DIO-WPRE-BGHpAP2A-nls-dTomato Ting
AAV-EF1a-DIO-GCaMP6f-P2A-nls-dTomatoGCaMP6f (Synthetic)Mammalian Expression, AAVpAAV-EF1a-DIO-WPRE-BGHpAP2A-nls-dTomato Ting
AAV-hSyn1-GCaMP6s-P2A-nls-dTomatoGCaMP6s (Synthetic)Mammalian Expression, AAVpAAV-hSyn1-WPRE-HGHpAP2A-nls-dTomato Ting
AAV-hSyn1-GCaMP6f-P2A-nls-dTomatoGCaMP6f (Synthetic)Mammalian Expression, AAVpAAV-hSyn1-WPRE-HGHpAP2A-nls-dTomato Ting
AAV-CaMKIIa-GCaMP6s-P2A-nls-dTomatoGCaMP6s (Synthetic)Mammalian Expression, AAVpAAV-CaMKIIa-WPRE-BGHpAP2A-nls-dTomato Ting
AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomatoGCaMP6f (Synthetic)Mammalian Expression, AAVpAAV-CaMKIIa-WPRE-BGHpAP2A-nls-dTomato Ting
pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-mKate2oChIEF(E163A/T199C) (Synthetic)Mammalian Expression, AAVpAAV-CaMKIIa-WPRE-HGHpA E163A/T199C P2A-mKate2 Ting
pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-EGFPoChIEF(E163A/T199C) (Synthetic)Mammalian Expression, AAVpAAV-CaMKIIa-WPRE-HGHpA E163A/T199C P2A-EGFP Ting
AAV-EF1a-DIO-oChIEF(E163A/T199C)-P2A-dTomato-WPRE-BGHpAoChIEF(E163A/T199C) (Synthetic)Mammalian Expression, AAVpAAV-EF1a-DIO-WPRE-BGHpA E163A/T199C P2A-dTomato Ting
AAV-EF1a-DIO-ChIEF(E162A/T198C)-P2A-dTomato-WPRE-BGHpAChIEF(E162A/T198C) (Synthetic)Mammalian Expression, AAVpAAV-EF1a-DIO-WPRE-BGHpA E162A/T198C P2A-dTomato Ting
pAAV-CaMKIIa-eArchT3.0-P2A-EGFP-WPRE-hGHpAeArchT3.0 (Other)Mammalian Expression, AAVpAAV-CaMKIIa-WPRE-HGHpAP2A-EGFP Ting
pGolden-AAVlacZAAVpAAV-MCS Luo
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pAmRuby2-P2A-GCaMP6m (Rattus norvegicus)AAVpAAV Bonhoeffer
AAV phSyn1(S)-FLEX-tdTomato-WPREtdTomatoAAVpAAV-MCS Zeng
AAV phSyn1(S)-tdTomato-WPREtdTomatoAAVpAAV-MCS Zeng
AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPREtdTomato-T2A-SypEGFPAAVpAAV-MCS Zeng
AAV phSyn1(S)-FlpO-bGHpAFlpO recombinase gene (Saccharomyces cerevisiae)Mammalian Expression, AAVpAAV-MCS Zeng
DRH322: AAV-CaMKIIa-QuasAr2-mO2QuasAr2-mOrange (Synthetic)AAVpAAVmOrange2 Cohen
DRH337: AAV-hsyn-CheRiff-eGFPCheRiff-eGFP (Synthetic)AAVpAAVeGFP Cohen
paavCAG-JxOFF-pre-mGRASP-mCeruleanpresynaptic mGRASP (Mus musculus)AAV, Cre/LoxpaavCAG-Jx Kim
paavCAG-pre-mGRASP-2A-dTomatopresynaptic mGRASP (Mus musculus)AAV, Cre/LoxpaavCAG Kim
paavCAG-JxON-pre-mGRASP-mCeruleanpresynaptic mGRASP (Mus musculus)AAV, Cre/LoxpaavCAG-Jx Kim
paavCAG-iCreimproved Cre recombinase (Mus musculus)AAVpaavCAG Kim
paavCAG-JxAAVpaavCAG Kim
paavCAG-JxOFF-post-mGRASP-2A-dTomatopostsynaptic mGRASP (Mus musculus)AAV, Cre/LoxpaavCAG-Jx Kim
pAAV-synP-FLEX-splitTVA-EGFP-B19GTVA-P2A-EGFP-P2A-B19G (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Wickersham
pAAV-synP-FLEX-splitTVA-EGFPsplitTVA-P2A-EGFP (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Wickersham
pAAV Syn ChR E90R-D156N-T159C 2A tDimerChannelrhodopsin-2 (Other), red fluorescent protein (Other)Mammalian Expression, AAVpAAV E90R, D156N, T159C Oertner
pAAV Syn ChR E90R-T159C 2A tDimerChannelrhodopsin-2 (Other), red fluorescent protein (Other)Mammalian Expression, AAVpAAV E90R, T159C Oertner
AAV-CAG::FLEX-rev:: ChR2HA-2a-hM4DChR2-2a-hM4D (Homo sapiens)AAV, Cre/LoxAAV22xHA Sternson
rAAV-CAG::FLEX-rev:: hM4D-2a-GFPhM4D-2a-GFP (Homo sapiens)AAV, Cre/LoxAAV2 Sternson
pZac2.1 gfaABC1D-EGFP-Kir4.1Kir4.1 (Rattus norvegicus)Mammalian Expression, AAV ; Adeno-Associated Virus ()pZac 2.1 Khakh
pAAV CaMKIIa ChR2 E90R D156N T159C 2A tDimerChannelrhodopsin-2 (Other), red fluorescent protein (Other)Mammalian Expression, AAVpAAV E90R, D156N, T159C Oertner
pZac2.1 gfaABC1D-lck-GCaMP6flck-GCaMP6fAAVpZac2.16xHis Khakh
pZac2.1 gfaABC1D-cyto-GCaMP6fGCaMP6fAAVpZac 2.1 Khakh
pAAV-CaMKIIa-SwiChRca-TS-EYFPiC1C2-TS-EYFP (Synthetic)Mammalian Expression, AAVAAV C128A EYFP Deisseroth
pAAV-Ef1a-DIO SwiChRca-TS-EYFPiC1C2-TS-EYFP (Synthetic)Mammalian Expression, AAV, Cre/LoxAAV C128A EYFP Deisseroth
pAAV-Ef1a-mCherry-IRES-CremCherry (Other), Cre (Synthetic)Mammalian Expression, AAVAAV Deisseroth
pAAV-EF1a-mCherry-IRES-DremCherry (Other), Dre (Synthetic)Mammalian Expression, AAVAAV Deisseroth
pAAV-EF1a-mCherry-IRES-FlpomCherry (Other), Flpo (Mus musculus)Mammalian Expression, AAVAAV Deisseroth
pAAV-EF1a-sCreCre (Synthetic)Mammalian Expression, AAVAAV Deisseroth
pAAV-EF1a-CreCre (Synthetic)Mammalian Expression, AAVAAV Deisseroth
pAAV-EF1a-FlpoFlpo (Mus musculus)Mammalian Expression, AAVAAV Deisseroth
pAAV-EF1a-vCrevCre (Synthetic)Mammalian Expression, AAVAAV Deisseroth
pAAV-Ef1a-fDIO hChR2(H134R)-EYFPhChR2(H134R)-EYFP (Synthetic)Mammalian Expression, AAVAAVEYFP Deisseroth
pAAV-Ef1a-dDIO hChR2(H134R)-EYFPhChR2(H134R)-EYFP (Synthetic)Mammalian Expression, AAVAAVEYFP Deisseroth
pAAV-Ef1a-fDIO EYFPEYFP (Other)Mammalian Expression, AAVAAV Deisseroth
pAAV-Ef1a-sCreDIO hChR2(H134R)-EYFPhChR2(H134R)-EYFP (Synthetic)Mammalian Expression, AAV ; sCre-DependentAAVEYFP Deisseroth
pAAV-Ef1a-vCreDIO hChR2(H134R)-EYFPhChR2(H134R)-EYFP (Synthetic)Mammalian Expression, AAV ; vCre-Dependent ChR2-EYFPAAVEYFP Deisseroth
pAAV-nEF Con/Fon hChR2(H134R)-EYFPChR2(H134R)-EYFP (Synthetic)Mammalian Expression, AAV ; Cre on/Flp on ChR2-EYFPAAVEYFP Deisseroth
pAAV-hSyn Con/Fon hChR2(H134R)-EYFPChR2(H134R)-EYFP (Synthetic)Mammalian Expression, AAV ; Cre on/Flp on ChR2-EYFPAAVEYFP Deisseroth
pAAV-hSyn Con/Foff hChR2(H134R)-EYFPChR2(H134R)-EYFP (Synthetic)Mammalian Expression, AAV ; Cre on/Flp off ChR2-EYFPAAVEYFP Deisseroth
pAAV-nEF Con/Foff hChR2(H134R)-EYFPChR2(H134R)-EYFP (Synthetic)Mammalian Expression, AAV ; Cre on/Flp off ChR2-EYFPAAVEYFP Deisseroth
pAAV-hSyn Coff/Fon hChR2(H134R)-EYFPChR2(H134R)-EYFP (Synthetic)Mammalian Expression, AAV ; Cre off/Flp on ChR2-EYFPAAVEYFP Deisseroth
pAAV-hnEF Coff/Fon hChR2(H134R)-EYFPChR2(H134R)-EYFP (Synthetic)Mammalian Expression, AAV ; Cre off/Flp on ChR2-EYFPAAVEYFP Deisseroth
pAAV-hSyn Con/Fon EYFPeYFP with introns (Synthetic)Mammalian Expression, AAV ; Cre on/Flp on eYFPAAV Deisseroth
pAAV-hSyn Con/Foff EYFPeYFP with introns (Synthetic)Mammalian Expression, AAV ; Cre on/Flp off eYFPAAV Deisseroth
pAAV-hSyn Coff/FonEYFPeYFP with introns (Synthetic)Mammalian Expression, AAV ; Cre off/Flp on eYFPAAV Deisseroth
AAV-Y-GECO1Y-GECO1.0 (Synthetic)Mammalian Expression, AAVpAAV Campbell
AAV-hSyn-Lyn-Y-GECO1Y-GECO1.0 (Synthetic)AAVAAV with hSyn promoter Campbell
pAAV/D377Y-mPCSK9proprotein convertase subtilisin/kexin type 9 (Mus musculus)Mammalian Expression, AAVpAAV/mU6.siRNA.shuttle D377Y Bentzon
pAAV/D374Y-hPCSK9proprotein convertase subtilisin/kexin type 9 (Homo sapiens)Mammalian Expression, AAVpAAV/mU6.siRNA.shuttle D374Y Bentzon
pAAV-mCherry-flex-dtAdtAMammalian Expression, AAV, Cre/LoxpAAV Uchida
N-Terminal Split Cas9 with GyrA inteinHumanized N-Terminal S. pyogenes Cas9 with GyrA Nsplit Intein (Homo sapiens)Mammalian Expression, AAV, CRISPRPlasmid 42230: pX330-U6-Chimeric_BB-CBh-hSpCas93xFlag, NLS, GyrA Nsplit Intein Bao
C-Terminal Split Cas9 with GyrA inteinHumanized C-Terminal S. pyogenes Cas9 with GyrA Csplit Intein (Homo sapiens)Mammalian Expression, AAV, CRISPRPlasmid 42230: pX330-U6-Chimeric_BB-CBh-hSpCas9NLS, GyrA Csplit Intein Bao
N-Terminal Split Cas9 D10A Nickase with GyrA inteinD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein (Homo sapiens)Mammalian Expression, AAV, CRISPRPlasmid 42235: pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) D10A nickase converting mutation to SpCas9 NLS, HA Tag, GyrA Nsplit Intein Bao
pAAV-CAG-FLEX-Mac-GFPMac-GFP (Other)Mammalian Expression, AAV, Cre/LoxAAV-FLEXGFP Boyden
pAAV-CaMKII-Chronos-GFPChronos-GFP (Other)Mammalian Expression, AAVAAVGFP Boyden
pAAV-Syn-ChrimsonR-GFPChrimsonR-GFP (Other)Mammalian Expression, AAVAAV K176R GFP Boyden
pAAV-Syn-CsChR-GFPCsChR-GFP (Other)Mammalian Expression, AAVAAVGFP Boyden
pAAV-CaMKII-Mac-GFPMac-GFP (Other)Mammalian Expression, AAVAAVGFP Boyden
pAAV-EF1a-FLEX-ArchT-GFPArchT-GFP (Other)Mammalian Expression, AAV, Cre/LoxAAV-FLEXGFP Boyden
pAAV-Syn-FLEX-Mac-GFPMac-GFP (Other)Mammalian Expression, AAV, Cre/LoxAAV-FLEXGFP Boyden
pAAV-Syn-Mac-GFPMac-GFP (Other)Mammalian Expression, AAVAAVGFP Boyden
mCherry_LD 0_CS G_tTA-BFPMESA target chain with mCherry ectodomain, cd28 transmembrane domain, wild type TEV cleavage sequence (Synthetic)Mammalian Expression, AAVpAAVEBFP Leonard
pAAV-Syn-GFPGFP (Synthetic)Mammalian Expression, AAVAAV Boyden
mCherry_LD 0_TEVMESA protease chain with mCherry ectodomain and TEV protease (Synthetic)Mammalian Expression, AAVpAAV Leonard
CD4_LD 0_CS G_tTA-BFPMESA target chain with CD4 ectodomain, cd28 transmembrane domain, wild type TEV cleavage sequence (Synthetic)Mammalian Expression, AAVpAAVEBFP Leonard
CD4_LD 0_TEVMESA protease chain with CD4 ectodomain and TEV protease (Synthetic)Mammalian Expression, AAVpAAV Leonard
dTomato_LD 0_CS G_tTA-BFPMESA target chain with dTomato ectodomain, cd28 transmembrane domain, wild type TEV cleavage sequence (Synthetic)Mammalian Expression, AAVpAAVEBFP Leonard
dTomato_LD 0_TEVMESA protease chain with dTomato ectodomain and TEV protease (Synthetic)Mammalian Expression, AAVpAAV Leonard
mCherry_LD 0_CS A_tTA-BFPMESA target chain with mCherry ectodomain, cd28 transmembrane domain, mutated TEV cleavage sequence (A in P1') (Synthetic)Mammalian Expression, AAVpAAVEBFP Leonard
mCherry_LD 0_CS M_tTA-BFPMESA target chain with mCherry ectodomain, cd28 transmembrane domain, mutated TEV cleavage sequence (M in P1') (Synthetic)Mammalian Expression, AAVpAAVEBFP Leonard
dTomato_LD 0_CS M_tTA-BFPMESA target chain with dTomato ectodomain, cd28 transmembrane domain, mutated TEV cleavage sequence (M in P1') (Synthetic)Mammalian Expression, AAVpAAVEBFP Leonard
FRB_LD 0_CS G_tTA-BFPMESA target chain with FRB ectodomain, cd28 transmembrane domain, wild type TEV cleavage sequence (Synthetic)Mammalian Expression, AAVpAAVEBFP Leonard
FKBP_LD 0_TEVMESA protease chain with FKBP rapamycin-binding ectodomain, TEV protease and mCherry fusion (Synthetic)Mammalian Expression, AAVpAAVmCherry Leonard
FKBP_SCF2_LD6_NTEVMESA split protease chain with FKBP rapamycin-binding ectodomain and N terminal fragment of TEV protease (Synthetic)Mammalian Expression, AAVpAAV Leonard
FRB_SCF2_LD6_CTEVMESA split protease chain with FRB rapamycin-binding ectodomain and C terminal fragment of TEV protease (Synthetic)Mammalian Expression, AAVpAAV Leonard
pAAV-Syn-ChR2(H134R)-GFPChR2(H134R)-GFP (Other)Mammalian Expression, AAVAAV H134R GFP Boyden
pAAV-Syn-ChR2-GFPChR2-GFP (Other)Mammalian Expression, AAVAAVGFP Boyden
pAAV-GFAP104-ChR2-mCherryChR2-mCherry (Other)Mammalian Expression, AAVAAVmCherry Boyden
pAAV-GFAP104-mCherrymCherry (Synthetic)Mammalian Expression, AAVAAV Boyden
pAAV-Syn-CoChR-GFPCoChR-GFP (Other)Mammalian Expression, AAVAAVGFP Boyden
pOTTC588 - pAAV c-fos Nuc-iRFPNuclear-localized Infrared Fluorescent ProteinMammalian Expression, AAVpOTTC4753xNLS Harvey
pOTTC589 - pAAV c-fos Nuc-eYFPNuclear-localized Enhanced Yellow Fluorescent ProteinMammalian Expression, AAVpOTTC4763xNLS Harvey
pAAV-Syn-Chronos-GFPChronos-GFP (Other)Mammalian Expression, AAVAAVGFP Boyden
pAAV-Syn-ChrimsonR-tdTChrimsonR-tdTomato (Other)Mammalian Expression, AAVAAVtdTomato Boyden
pAAV-CAG-FLEX-splitTVA950splitTVA950 (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Wickersham
pAAV-CAG-FLEX-splitTVA800splitTVA800 (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Wickersham
pAAV-CAG-FLEX-EGFPEGFP (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Wickersham
pAAV-CAG-FLEX-splitTVA-EGFPsplitTVA950-P2A-EGFP (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAVGFP Wickersham
pAAV-synP-FLEX-EGFP-B19GEGFP-P2A-B19G (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAVGFP Wickersham
pAAV-CAG-tdTomato (codon diversified)tdTomato (Synthetic)Mammalian Expression, AAVAAV with CAG promter codon diversified Boyden
pOTTC414 - pAAV EF1a hPREPProlyl oligopeptidase (Homo sapiens)Mammalian Expression, AAVpOTTC374 - pAAV EF1a DIO iRFP Harvey
pOTTC446 - pAAV EF1a hPREP(S554A)Prolyl oligopeptidase (Homo sapiens)Mammalian Expression, AAVpOTTC374 - pAAV EF1a DIO iRFP S554A Harvey
pOTTC293 - pAAV EF1a V5-synuclein (WT)alpha-synuclein (Homo sapiens)Mammalian Expression, AAVpAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (Addgene 20297)V5 Harvey
pOTTC407 - pAAV EF1a eGFPenhanced Green Fluorescent Protein (Other)Mammalian Expression, AAVpOTTC374 - pAAV EF1a DIO iRFP Harvey
pAAV-myrSNAPSNAP-tag (Synthetic), histone-GFP (Synthetic)Mammalian Expression, Mouse Targeting, AAVpAAV-CMV Jefferis
pAAV-myrSNAP-CONSNAP-tag (Synthetic), histone-GFP (Synthetic)Mammalian Expression, Mouse Targeting, AAVpAAV-CMV Jefferis
AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR (AAV-KPL)sgRNA (Synthetic), Renilla luciferase, Cre recombinase, KrasG12D HDR donor (Mus musculus)Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPRAAVRluc-P2A, Cre-HA Zhang
AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITRsgRNA, Renilla luciferase, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, LuciferaseAAVRluc-P2A, Cre-HA Zhang
AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITRsgRNA, Renilla luciferase, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, LuciferaseAAVRluc-P2A, Cre-HA Zhang
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPRAAVCre-HA Zhang
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPRAAVCre-HA Zhang
AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPRAAVCre-HA Zhang
AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITRsgRNA, Cre recombinase, EGFPMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPRAAVEGFP-KASH, Cre-HA-P2A Zhang
AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITRsgRNA, Cre recombinase, EGFPMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPRAAVEGFP-KASH, Cre-HA-P2A Zhang
AAV-FLEX-FLIM-AKARFLIM-AKAR (Synthetic)Mammalian Expression, AAV, Cre/LoxAAV-FLEX Sabatini
AAV-FLEX-FLIM-AKART391AFLIM-AKART391A (Synthetic)Mammalian Expression, AAV, Cre/LoxAAV-FLEX changed Threonine 391 to Ananine Sabatini
AA0250-mCherry-2a-hM4D-nrxn1a revmCherry, muscarinic receptor 4, axon targeted variant (Homo sapiens)AAV, Cre/LoxAAV22xHA Sternson
pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomatoFLEX-mNaChBac-T2A-tdTomato (Other)AAVpAAV Scanziani
AAV-FLEX-VAMP2:HRPVAMP2:HRP (Bos taurus)AAV, Cre/LoxAAV-FLEXMyc Sternson
pAAV-EF1α-F-FLEX-mNaChBacMut-T2A-tdTomatoFLEX-mNaChBacMut-T2A-tdTomato (Other)AAVpAAV E191K Scanziani
pAAV-EF1α-F-FLEX- Kir2.1-T2A-tdTomatoFLEX- Kir2.1-T2A-tdTomato (Mus musculus)AAVpAAV Scanziani
pAAV-hSynapsin-FlpoFlpoAAVpAAV Scanziani
PX551SpCas9 (Synthetic)Mammalian Expression, AAV, CRISPRpAAVHA Zhang
PX552U6_(SpaI)_sgRNA (Synthetic), Syn_EGFP-KASH (Synthetic)Mammalian Expression, Mouse Targeting, AAV, CRISPRpAAV Zhang
AAV-hSyn-REX-GECO1REX-GECO1 (Synthetic)Mammalian Expression, AAVpAAV Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, S142P, D147V, E148G, P220L, N257I, A302P, M339L, T382S Campbell
AAV-hSyn-REX-GECO0.9REX-GECO0.9 (Synthetic)Mammalian Expression, AAVpAAV Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, E138V, S142P, D147V, P220L, N257I, N267D, A302P, M339L, T382S Campbell
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNAhSaCas9 (Other), Chimeric guide for SaCas9 (Other)Mammalian Expression, AAV, CRISPRpAAVNLS, 3xHA Zhang
pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpAhSaCas9 (Other)Mammalian Expression, AAV, CRISPRpAAVNLS, 3xHA Zhang
pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNAhSaCas9 (Other), Chimeric guide for SaCas9 (Other)Mammalian Expression, AAV, CRISPRpAAVNLS, HA, OLLAS tag Zhang
pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpAhSaCas9 (Other)Mammalian Expression, AAV, CRISPRpAAV D10A, N580A NLS, 3xHA Zhang
pAAV-UbC-tdTomatotdTomato (Other)Mammalian Expression, AAV, Synthetic BiologypAAV-SIBR-anti_I Tsoulfas
pAAV-UbC-eGFPeGFP (Other)Mammalian Expression, AAVpAAV-SIBR-anti_l Tsoulfas
pAAV-CaMKII-Chrimson-GFPChrimson-GFP (Other)Mammalian Expression, AAVAAV-CaMKIIGFP Boyden
pAAV-Syn-FLEX-rc[Chronos-GFP]Chronos-GFP (Other)Mammalian Expression, AAVAAV-Syn-FLEXGFP Boyden
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato]ChrimsonR-tdTomato (Other)Mammalian Expression, AAVAAV-Syn-FLEX Chrimson K176R mutant tdTomato Boyden
pAAV-Syn-FLEX-rc[CoChR-GFP]CoChR-GFP (Other)Mammalian Expression, AAVAAV-Syn-FLEXGFP Boyden
pAAV-EF1α-FLEX-rc[Chronos-GFP]Chronos-GFP (Other)Mammalian Expression, AAVAAV-EF1α-FLEXGFP Boyden
pAAV-Syn-Chronos-tdTomatoChronos-tdTomato (Other)Mammalian Expression, AAVAAV-SyntdTomato Boyden
pAAV-UbCMammalian Expression, AAV ; EucaryoticpAAV-SIBR-anti_I Tsoulfas
AAV-FLIM-AKARFLIM-AKAR (Synthetic)Mammalian Expression, AAVAAV-ChR2-mCherry Sabatini
AAV-FLEX-PKIalpha-IRES-nls-mRuby2PKIalpha (Mus musculus)Mammalian Expression, AAV, Cre/LoxAAV-FLEX-tmeGFP-IRES-nls-mRuby2 Sabatini
AAV-FLEX-tmeGFP-IRES-nls-mRuby2nls-mRuby2 (Synthetic)Mammalian Expression, AAV, Cre/LoxAAV-FLEX-FLIM-AKAR Sabatini
pAAV CTG 700xCTG REPEATS (Synthetic)Mammalian Expression, AAVunknown CTG 700x that is the mutation found in Myotonic Dystrophic type 1 EGFP Charlet-Berguerand
pAAV CCTG 1200xCCUG 1200x (Synthetic)Mammalian Expression, AAVunknown Charlet-Berguerand
pAAV-Syn-ArchT-GFPArchT-GFP (Other)Mammalian Expression, AAVAAVGFP Boyden
pEF1a-CRY2PHR-SID4XSID4X-CYR2PHR (Synthetic)Mammalian Expression, AAVpAAV Kong
pOTTC809 - pAAV-EF1a-CRTsigpep-GCaMP3-KDELER-localized GCaMP3(wt) (Synthetic)AAVpOTTC374 - pAAV EF1a DIO iRFP Harvey
pOTTC810 - pAAV-EF1a-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDELER-localized low-affinity GCaMP3(10.19) (Synthetic)AAVpOTTC374 - pAAV EF1a DIO iRFP Harvey
pOTTC813 - pAAV-SYN1-CRTsigpep-GCaMP3-KDELER-localized GCaMP3(wt) (Synthetic)AAVAddgene Plasmid #50465 Harvey
pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDELER-localized low-affinity GCaMP3(10.19) (Synthetic)AAVAddgene Plasmid #50465 Harvey
pAAV-RAM-d2TTA::TRE-MCS-WPRE-pAAAVDerived from AAV V032 Lin
hSyn-FAS-DO-ReaChR-mCitrine-WPREhSyn-FAS-DO-ReaChR-mCitrine-WPRE (Synthetic)Mammalian Expression, AAVpAAVReaChR tagged with mCitrine Svoboda
pAAV-CAG-FLEX-TVA66T-EGFPTVA66T-EGFP (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Glutamic acid 66 to Threonine EGFP Wickersham
pAAV-synP-FLEX-TVA66T-EGFPTVA66T-EGFP (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Glutamic acid 66 to Threonine EGFP Wickersham
pAAV-synP-FLEX-TVA66T-EGFP-B19GTVA66T-EGFP-B19G (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Glutamic acid 66 to Threonine EGFP Wickersham
pAAV-CaMKII-GFPGFP (Synthetic)Mammalian Expression, AAVAAV Boyden
7M87M8 cap (Other)AAVXX2 7mer insertion in the AAV2 cap Schaffer
shh10shh10 cap (Other)AAVXX2 I319V, N451D, D532N Schaffer
pAAV-CMV-iRFPiRFP (Other)Mammalian Expression, AAVpAAV-CMV Ichinose
pAAV-hsyn-Jaws-KGC-GFP-ER2Jaws-KGC-GFP-ER2 (Other)Mammalian Expression, AAVpAAV K200R W214F KGC, GFP, ER2 Boyden
pAAV-CaMKII-Jaws-KGC-GFP-ER2Jaws-KGC-GFP-ER2 (Other)Mammalian Expression, AAVpAAV K200R W214F KGC, GFP, ER2 Boyden
pAAV-hsyn-Jaws-GFP-ER2Jaws-GFP-ER2 (Other)Mammalian Expression, AAVpAAV K200R W214F GFP, ER2 Boyden
pSR651modified AAV-2 rep78 (Other), modified AAV-1 cap (Other)Insect ExpressionpFastBac-Dual Kotin
pSR657modified AAV-2 rep78 (Other), modified AAV-2 cap (Other)Insect ExpressionpFastBac-Dual Kotin
pSR646modified AAV-2 rep78 (Other), modified AAV-6 cap (Other)Insect ExpressionpFastBac-Dual Kotin
pSR660modified AAV-2 rep78 (Other), modified AAV-8 cap (Other)Insect ExpressionpFastBac-Dual Kotin
pAAV-hSyn-dF-HA-KORD-IRES-mCitrinehSyn-dF-HA-KORD-IRES-mCitrine (Homo sapiens)AAVpAAV2HA, mCitrine Roth
pAAV-CaMKIIa-HA-KORD-IRES-mCitrineCaMKIIa-HA-KORD-IRES-mCitrine (Homo sapiens)AAVpAAV2HA, mCitrine Roth
AAV phSyn1-RSR-FLEX-ChR2(H134R)-EYFP-WPRE-bGHpAChR2(H134R)-EYFP (Other)AAVpAAV-MCS H134R variant EYFP Zeng
AAV phSyn1-FSF-FLEX-ChR2(H134R)-EYFP-WPRE-bGHpAChR2(H134R)-EYFP (Other)AAVpAAV-MCS H134R variant EYFP Zeng
pAAV2_VP1_RaPID_r1c3mCherryAAVpAAV2 Suh
pRC_RR_VP1_r1c3mCherryAAVAAV2_G453_delGTTTQSR Suh
pAAV CaMKIIa iChloC 2A tDimerChannelrhodopsin-2 (Synthetic), red fluorescent protein (Other)Mammalian Expression, AAVpAAV E83Q,E90R,E101S,D156N,T159C Oertner
pAAV Syn hBE Rh Guanylyl Cyclase1 2A tDimerhbeRhGC (Other), red fluorescent protein (Other)Mammalian Expression, AAVpAAV Oertner
pAAV-cFos-tTA-pAcfos promoter linked to the tet activator gene (Synthetic)Mammalian Expression, AAVpUCno Wisden
pAAV-PTRE-tight-hM3Dq-mCherrypTIGHT promoter-hM3Dq-mCherry (Synthetic)Mammalian Expression, AAVpUC Wisden
pAAV-Ef1a-DIO-OMOR-eYFPOpto Mu opioid receptor (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxpAAVeYFP Bruchas
pAAV-EF1a-GCaMP6s-WPRE-pGHpAGCaMP6s (Other)Mammalian Expression, AAVpAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpAXpress epitope, T7 tag, 6xHis Roska
pAAV-EF1a-tdTomato-WPRE-pGHpAtandem dimer tomato (Other)Mammalian Expression, AAVpAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA Roska
pAAV-EF1a-CVS-G-WPRE-pGHpARabies virus strain CVS-11 glycoprotein (G) (Other)Mammalian Expression, AAVpAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA Roska
AAV-CMV-SOD2-2A-Catalase-WPRESOD-2A-Catalase (Mus musculus)AAVAAV-MCS8 Deleted the Peroxisome Targeting Signal from Catalase and added the mitochondrial targeting sequence to the N-terminus of catalase Cepko
AAV-CMV-Nrf2Nrf2 (Mus musculus)AAVAAV-MCS8 Cepko
AAV-CMV-Flag-PGC1a-6HisPGC1a (Mus musculus)AAVAAV-GFPFlag tag, 6XHis Cepko
CAG-FLEx(FRT)-TCTVA-mCherry fusionMammalian Expression, AAVpAAV Luo
CAG-FLEx(FRT)-Grabies glycoproteinMammalian Expression, AAVpAAV Luo
pTCAV-FLEx(loxP)-FlpOFlpOMammalian ExpressionpTCAV Luo
pAAV-hsyn-flex-dsRed-shvgatAAV-hsyn-flexed-dsRed-miR30-vgat2.shRNA (Mus musculus)Mammalian Expression, Mouse Targeting, AAV, RNAi, Cre/LoxpUC Wisden
AAV-actin prom-dsRed-scramble shRNAactin prom-dsRed-scramble shRNA (Gallus gallus)Mammalian Expression, AAV, RNAipUC Wisden
AAV-actin prom-dsRed-adra2a.1227.shRNAdsRed and shRNA to knock down the mouse adra2 receptor (Gallus gallus)Mammalian Expression, AAVpUC Wisden
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA3xgRNA;PTENA, p53B,SMAD4A (Synthetic), FlPO (Synthetic)Mammalian Expression, AAV ; Flp/FrtAmp Elverløv-Jakobsen
AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTRFlPO (Synthetic)Mammalian Expression, AAVamp Elverløv-Jakobsen
AAV_NLS-dSaCas9-NLS-VPRdSaCas9-VPR (Synthetic)Mammalian Expression, AAVpX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA Plasmid #61592VPR Church
AAV_NLS-SaCas9-NLS-VPRSaCas9-VPR (Synthetic)Mammalian Expression, AAVpX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA Plasmid #61592VPR Church
AAV-Cre-GFPCre (Other)Mammalian Expression, AAV, Cre/LoxpAAV-MCSEGFP Nestler
AAV-DeltaFosBDeltaFosB-IRES-GFPMammalian Expression, AAVpAAV-MCS truncated splice variant of FosB Nestler
AAV-DeltaJunDDeltaJunD-IRES-GFPMammalian Expression, AAVpAAV-MCS truncated splice variant Nestler
AAV-CREBCREB (Rattus norvegicus)Mammalian Expression, AAVpAAV-MCSEGFP Nestler
AAV-mCREBmCREB (Rattus norvegicus)Mammalian Expression, AAVpAAV-MCS S133A EGFP Nestler
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pAmRuby2-P2A-GCaMP6s (Rattus norvegicus)AAVpAAV Cre-dependent expression from inverted open reading frame (i.e. 'FLEXED') Bonhoeffer
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6f-WPRE-pAmRuby2-P2A-GCaMP6f (Rattus norvegicus)AAVpAAV Bonhoeffer
pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pAmRuby2-P2A-GCaMP6s (Rattus norvegicus)AAVpAAV Cre-dependent expression from inverted open reading frame (i.e. 'FLEXED') Bonhoeffer
pAnc80L65Ancestral AAV Capsid Anc80L65 (Synthetic)Mammalian Expression, AAV, Synthetic Biologysynthetic Vandenberghe
pAAV-MCS-shCHD5 #1CHD5 (Mus musculus)Mammalian Expression, AAV, RNAipAAV-MCS-CMV-eGFP Bracken
pAAV-MCS-shCHD5 #2CHD5 (Mus musculus)Mammalian Expression, AAV, RNAipAAV-MCS-CMV-eGFP Bracken
pAAV-EF1a-N-CretrcintGkozak consensus - N-CretrcintG (Synthetic)Mammalian Expression, AAV, Synthetic BiologypAAV-EF1a-GTB Cepko
pAAV-EF1a-C-CreintGkozak consensus - C-CreintG (Synthetic)Mammalian Expression, AAV, Synthetic BiologypAAV-EF1a-GTB Cepko
pAAV-CAMammalian Expression, AAV, Cre/LoxpAAV Uchida
pAAV-EF1a-flex-TVAAvian sarcoma and leukemia virus receptor 950 (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAVFLAG Uchida
pAAV:cTNT::LuciferaseFirefly luciferase (Other)AAVAAV2/9.cTnT.PI.EGFP.RBG Pu
pAAV.cTNT.iCreimproved cre (iCre) recombinase and tdTomato (Synthetic)AAVAAV2/9.cTnT.PI.EGFP.RBGThe iCre coding frame and tdTomato coding frame is separated by IRES sequnece Pu
pAAV-FLEX-NBL10NBL10 (Mus musculus)Mammalian Expression, AAV, Cre/LoxpAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpAHA Friedman
pEMS2157ssAAV-MCS-EmGFP-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2158ssAAV-MCS-EmGFP (Synthetic)Mammalian Expression, AAVAAV2 Simpson
pEMS2159ssAAV-MCS-iCre-WPRE (Synthetic)Mammalian Expression, AAVAAV2 Simpson
AAV-mOXT-hM3Dq-mCherry-WPREhM3Dq-mCherry (Homo sapiens)AAVpAAVmCherry Geschwind
pAAV EF1a DIO iChloC 2A dsRedChannelrhodopsin-2 (Synthetic), red fluorescent protein (Other)Mammalian Expression, AAVpAAV E83Q,E90R,E101S,D156N,T159C Oertner
pAAV-hysn-flex-dsRed-shscramblehuman synapsin promoter-flex switch-dsRed-shscramble (Homo sapiens)Mammalian Expression, AAV, RNAi, Cre/LoxpUC Wisden
pAAV-flex-rev-g2-2A-VenusMammalian Expression, AAV, Cre/LoxpUC Wisden
pAAV-UbC-eGFP-FeGFP-F (Synthetic)Mammalian Expression, AAVpAAV-SIBR-anti_Icontains 20- amino-acid farnesylation signal from c-Ha-Ras and a 4 aminoacid linker Tsoulfas
pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRubymGFP, SynaptophysinAAV, Cre/LoxpAAVmRuby, Palmitoylation signal Luo
pAAV hSyn FLExFRT mGFP-2A-Synaptophysin-mRubymGFP, SynaptophysinAAVpAAVmRuby, Palmitoylation signal Luo
pAAP2AAP2 (Other)Mammalian Expression, AAVpcDNA3 Vandenberghe
J7AAV-HDR Fah.2Fah (Mus musculus)AAVAAV Xue
J8AAV-HDR Ctnnb1.1Ctnnb1 (Mus musculus)AAVAAV Xue
DIO-EF1a-FLEX-H2B-GFP-P2A-N2c(G)H2B-GFP-P2A-N2c(G)Mammalian Expression, AAVpAAV Ef1a DIO Jessell
DIO-EF1a-FLEX-H2B-3XHA-P2A-N2c(G)H2B-3XHA-P2A-N2c(G)Mammalian Expression, AAVpAAV Ef1a DIO Jessell
pAAV-CAG-PeredoxPeredox (Synthetic)Mammalian Expression, AAVAAV-Flex Yellen
CAG Double flox Synaptophysin-EGFP WPREsynaptophysin-eGFP (Rattus norvegicus)Mammalian Expression, AAVAAV CAGEGFP Stryker
pAAV-SEPT_Cdk2-T160A-siRCdk2-LHA-siR (Homo sapiens), Cdk2-RHA-T160A (Homo sapiens)AAVpAAV-SEPT siRNA target site mutated, T160 mutated to Ala Dowdy
pAAV-SEPT_Cdk2-T160E-siRCdk2-LHA-siR (Homo sapiens), Cdk2-RHA-T160E (Homo sapiens)AAVpAAV-SEPT siRNA target site mutated, T160 mutated to Glu Dowdy
AAV-hSyn-FlicR1FlicR1 (Synthetic)Mammalian Expression, AAVpAAV Campbell
AAV Synapsin Intron H2B Gcamp 6f wpre Pzac2.1GCaMP6f (Rattus norvegicus)AAVPzac2.1H2B Looger
AAV Synapsin Intron H2B Gcamp 6s wpre Pzac2.1GCaMP6s (Rattus norvegicus)AAVAAV synapsin intronH2B Looger
AAV Cag Flex H2B Gcamp6f reverseGcamp6f (Rattus norvegicus)AAVAAV CAG FlexH2B Looger
AAV Cag Flex H2B Gcamp6s reverseGcamp6s (Rattus norvegicus)AAVAAV CAG FlexH2B Looger
pGG-9.47_VP1,3 #2515AAV2 Rep (Other), AAV9.47 VP1 (Other), AAV9.47 VP3 (Other)AAVpGG Sena-Esteves
pGG-9.47_VP2_AS #2562AAV2 Rep (Other), AAV9.47 VP2-AS (Other)AAVpGG Sena-Esteves
pAR-9.47_VP1,3AAV2 Rep (Other), AAV9.47 VP1 (Other), AAV9.47 VP3 (Other)AAVpAR Sena-Esteves
pAR-9.47_VP2_ASAAV2 Rep (Other), AAV9.47-VP2_AS (Other)AAVpAR19 alanines fused to VP2 of AAV9.47 Sena-Esteves
pAAV-Ef1a-DIO-PBG-WPRE-hGHPBG (chimeric rabies Glycoprotein) (Other)AAVpAAV-EF1a-DIO Callaway
pAAV-Ef1a-DIO-H2B-GFP-2A-oG-WPRE-hGHH2B-GFP and oG (optimized Glycoprotein) (Other)Mammalian Expression, AAVpAAV-EF1a-DIO chimeric glycoprotein Callaway
pAAV-Ef1a-DIO-oG-WPRE-hGHoG (optimized Glycoprotein) (Other)Mammalian Expression, AAVpAAV-EF1a-DIO chimeric glycoprotein Callaway
pAAV-CAG-fDIO-oG-WPRE-SV40pAoG (optimized Glycoprotein) (Other)Mammalian Expression, AAVpAAV-CAG-fDIO chimeric glycoprotein Callaway
pAAV-CAG-FLEX-oG-WPRE-SV40pAoG (optimized Glycoprotein) (Other)Mammalian Expression, AAVpAAV-CAG-FLEX chimeric glycoprotein Callaway
pAAV-CMV-DIO-TRPV4-p2A-ferritin-sNRPpATRPV4 (Rattus norvegicus), ferritin (FTL and HTL1) (Homo sapiens)Mammalian Expression, AAV, Cre/LoxpAAVFLAG, p2A Guler
pAAV-CMV-DIO-Magneto2.0-sNRPpAMagneto2.0 (Homo sapiens)Mammalian Expression, AAV, Cre/LoxpAAV TRPV4: delta 760-871 Flag Guler
pAAV CD68-hM4D(Gi)-mCherryhM4D(Gi)-mCherry (Synthetic)Mammalian Expression, AAVAAV Roth
pOTTC710 - pAAV EF1a DIO Mem-AcGFPMem-AcGFP (Other)Mammalian Expression, AAV, Cre/LoxpOTTC374 - pAAV EF1a DIO iRFPPalmitylation site Harvey
pOTTC1012 - pAAV EF1a DIO Nuc-eYFPNuc-eYFP (Other)Mammalian Expression, AAV, Cre/LoxpOTTC374 - pAAV EF1a DIO iRFPNLS Harvey
pAAV-CIBN-CreCN-terminal portion of the CIB1 transcription factor (Arabidopsis thaliana)AAVpAAV Bruchas
pAAV-CRY2-CreNsecond half of the cre recombinase fused to CRY2 (cryptochrome 2) that has absorbed blue light (Kennedy et al., 2010)AAVpAAV Bruchas
pOTTC533 - pAAV SYN1 eGFP-2A-mKv1.2eGFP-2A-mKv1.2 (Mus musculus)AAVAddgene Plasmid #50465 Harvey
p-AAV-sh[SNCA]snca (Rattus norvegicus)Mammalian Expression, AAV, RNAipAAV-D(+)-U6-siRNA-CMV-GFP Burton
p-AAV-sh[control]GFPMammalian Expression, AAV, RNAipAAV-D(+)-U6-siRNA-CMV-GFP Burton
pAAV-EF1a-Flp-DOG-NWFlp-DOG (Synthetic)Mammalian Expression, AAV, Synthetic BiologypAAV-EF1a-GTB Cepko
pAAV-CAG-FLEXFRT-ChR2(H134R)-mCherryReversed ChR2(H134R)-mCherry (Synthetic)Mammalian Expression, AAV, Synthetic BiologypAAV-CAG-FRTed-SynGFPreverse-WPRE Cepko
pAR-B1(1986.1)AAV2 Rep (Other), AAV-B1 capsid (Other)Mammalian Expression, AAVpAR Sena-Esteves
pGG-B1AAV2 Rep (Other), AAV-B1 capsid (Other)Mammalian Expression, AAVpGG Sena-Esteves
pZac2.1 SV40-CMV-SaCas9-3xNLSSV40-CMV-SaCas9-3xNLS (Synthetic)Mammalian Expression, AAV, CRISPRpZac2.1HA tag Wagers
pZac2.1 U6-SaDMDR7-U6-SaDMDL2U6-SaDMDR7-U6-SaDMDL2 (Synthetic)Mammalian Expression, AAV, CRISPRpZac2.1 Wagers
pZac2.1 U6-SaAi9L-U6-SaAi9RgRNAs for SaCas9 targeting Ai9 locus (Synthetic)Mammalian Expression, AAV, CRISPRpZac2.1 Wagers
pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2 (Synthetic)Mammalian Expression, AAV, CRISPRpZac2.1HA tag Wagers
pZac2.1 EFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2EFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2 (Synthetic)Mammalian Expression, AAV, CRISPRpZac2.1HA tag Wagers
pEMS2043ssAAV Ple254-EmGFP WPRE (Homo sapiens)AAVssAAV2 Simpson
pEMS2044ssAAV Ple255-EmGFP WPRE (Homo sapiens)AAVssAAV2 Simpson
pEMS2045ssAAV Ple256-EmGFP WPRE (Homo sapiens)AAVssAAV2 Simpson
pEMS2046ssAAV Ple257-EmGFP WPRE (Homo sapiens)AAVssAAV2 Simpson
pEMS2047ssAAV Ple258-EmGFP WPRE (Homo sapiens)AAVssAAV2 Simpson
pEMS2048ssAAV Ple259-EmGFP WPRE (Homo sapiens)AAVssAAV2 Simpson
pEMS2049ssAAV Ple260-EmGFP WPRE (Homo sapiens)AAVssAAV2 Simpson
AAV-FLEX-EGFP-mir30(Scn9a-scrambled)EGFP (Mus musculus)Mammalian Expression, AAV, Cre/LoxAAV Sternson
AAV-FLEX-EGFP-mir30(Scn9a)EGFP (Mus musculus)Mammalian Expression, AAV, Cre/LoxAAV Sternson
pAAV-Ef1a-DIO_EGFP-GFE3GFP-GFE3 (Rattus norvegicus)Mammalian Expression, AAV, Cre/Lox, Synthetic BiologypCAGGFP, HA Arnold
pAAV-Ef1a-DIO_EGFP-RandE3GFP-RandE3 (Rattus norvegicus)Mammalian Expression, AAV, Cre/Lox, Synthetic BiologypCAGGFP, HA Arnold
AAV-CAG-DIO-erHRP(N175S mutant)erHRP(N175S mutant) (Synthetic)Mammalian Expression, AAV, Cre/LoxAAV N175S mutation HA tag Sanes
AAV-CAG-DIO-APEX2NESAPEX2NES (Synthetic)Mammalian Expression, AAV, Cre/LoxAAVV5 Sanes
AAV-CAG-DIO-mAPXmAPX (Synthetic)Mammalian Expression, AAV, Cre/LoxAAV Sanes
pAAV-2AneoAAV, Cre/Lox ; a platform vector to construct targeting vectors by inserting 5' and 3' armspAAV-MCS Konishi
pAAV-2Aneo v2AAV, Cre/Lox ; a platform vector to construct targeting vectors by inserting 5' and 3' armspAAV-MCS Konishi
pAAV2.5-THP-dsRed2rat TH promoter (Rattus norvegicus)AAVpAAV2.5 Kim
pAAV2.5-THP-GFPrat TH promoter (Rattus norvegicus)AAVpAAV2.5 Kim
pAAV2.5-THP-GFP/WGArat TH promoter (Rattus norvegicus)AAVpAAV2.5 Kim
pVH0093xFLAG-Venus YFP-AAV, CusR, AraCBacterial Expression, Synthetic BiologypBBR1C-terminal LZx domain, N-terminal 3xFLAG tag, C-terminal AAV degradation tag Murray
AAV-flex-plapplap (Homo sapiens)AAVpAAV Shah
TR-GFPGFPMammalian Expression, AAVAAV ITR backbone Asokan
TR- ATG-HP-GFPGFP (Other)Mammalian Expression, AAVAAV ITR backbone Inserted 30 nt hairpin which is targeted by Csy4 immediately following the start codon. Asokan
TR-5'UTR-HP-GFPGFP (Other)Mammalian Expression, AAVAAV ITR backbone Inserted 30 nt hairpin which is targeted by Csy4 in the 5'UTR Asokan
TR-GFP-3'UTR-HPCsy4 hairpin (Other)Mammalian Expression, AAVTR-GFP Asokan
TR-Csy4Csy4 (Other)Mammalian Expression, AAVAAV ITR backbone Asokan
TR-Csy4-H29ACsy4-H29A (Other)Mammalian Expression, AAVAAV ITR backbone His29 mutated to Ala Asokan
TR-Csy4-R115A/R119ACsy4-R115A/R119A (Other)Mammalian Expression, AAVAAV ITR backbone Arg115 and Arg119 both mutated to Ala Asokan
pAAV-SMVP-Cas9NCas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-SMVP-Cas9CCas9C (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-CASI-Cas9CCas9C (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-CMV-Cas9C-VPRCas9C-VPR (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-SMVP-Cas9N-U6-gRNA M3Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-SMVP-Cas9N-U6-gRNA M4Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-SMVP-Cas9N-U6-gRNA TdLCas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-SMVP-Cas9N-U6-gRNA TdRCas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-CASI-Cas9C-P2A-turboGFPCas9C (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-SMVP-Cas9N-U6-gRNA P1Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-SMVP-Cas9N-U6-gRNA P2Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologypZac2.1 Church
pAAV-CBA-DIO-hM4Di-mCherryhM4D(Gi)-mCherryAAVpAAVmCherry Sabatini
rAAV2-retro helperrep (Other), rAAV2-retro cap (Other)AAV, Unspecified ; helper vectorAAV helper vector Pro2Ala, possibly Asp613Gly, changes made to AAV2 cap: N382D, V708I, insertion of LADQDYTKTA between N587 and R588 Karpova
TET1CD-CRY2-EGFPTET1 (Homo sapiens), CRY2 (Arabidopsis thaliana), EGFP (Other)Mammalian Expression, AAVpAAV_EF1a_WPRE_hGHpA CRY2PHR (N-terminal photolyase homology region domain of CRY2 only) NLS-VP64, 2A, NLS(alpha-imp) Irudayaraj
DNMT3ACD-CRY2-EGFPDNMT3A (Homo sapiens), CRY2 (Arabidopsis thaliana), EGFP (Other)Mammalian Expression, AAVpAAV_EF1a_WPRE_hGHpA CRY2PHR (N-terminal photolyase homology region domain of CRY2 only) NLS-VP64, 2A, NLS(alpha-imp) Irudayaraj
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pAH1/TO gRNA Expression Cassette Containing Tet2 gRNAMammalian Expression, AAV, CRISPRAAVCMV promoter driving expression of TetR-P2A-GFP-KASH fusion protein. Ploski
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pAH1/TO Empty gRNA Expression CassetteMammalian Expression, AAV, CRISPRAAVCMV promoter driving expression of TetR-P2A-GFP-KASH fusion protein. Ploski
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pAH1/TO-L gRNA Expression Cassette Containing Tet2 gRNAMammalian Expression, AAV, CRISPRAAVCMV promoter driving expression of TetR-P2A-GFP-KASH fusion protein. Ploski
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pAH1/TO-L Empty gRNA Expression CassetteMammalian Expression, AAV, CRISPRAAVCMV promoter driving expression of TetR-P2A-GFP-KASH fusion protein. Ploski
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pAU6/TO gRNA Expression Cassette Containing Tet2 gRNAMammalian Expression, AAV, CRISPRAAVCMV promoter driving expression of TetR-P2A-GFP-KASH fusion protein. Ploski
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pAU6/TO Empty gRNA Expression CassetteMammalian Expression, AAV, CRISPRAAVCMV promoter driving expression of TetR-P2A-GFP-KASH fusion protein. Ploski
pscAAV-CAG-GFPenhanced green fluorescent protein (Other)Mammalian Expression, AAVpAAV with one trs deleted ITR and CAG promoter Kay
pscAAV-CAG-RLucRenilla Luciferase (Other)Mammalian Expression, AAVpAAV with one trs deleted ITR and CAG promoter Kay
pAAV-CAG-FLucFirefly Luciferase (Other)Mammalian Expression, AAVpAAV with CAG promoter Kay
pAAV-CAG-RLucRenilla Luciferase (Other)Mammalian Expression, AAVpAAV with CAG promoter Kay
pAAV-EF1a-Flex-PAK1-AID-ires-EGFPPAK1-AID-ires-EGFPMammalian Expression, AAV, Cre/LoxpAAV Kong
pAAV-EF1a-Flex-CA-AMPK-H150R-T2A-mCherryCA-AMPK-2A-mCherryMammalian Expression, AAV, Cre/LoxpAAV H150R Kong
pAAV-EF1a-Flex-DN-AMPK-K45R-T2A-mCherryDN-AMPK-2A-mCherryMammalian Expression, AAV, Cre/LoxpAAV K45R Kong
pAAV-hDlx-Flex-dTomato-Fishell_7tdTomato (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Fishell
pAAV-hDlx-Flex-GFP-Fishell_6eGFP (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Fishell
pAAV-hDlx-GiDREADD-dTomato-Fishell-5hM4DiMammalian Expression, AAVpAAV Fishell
pAAV-hDlx-GqDREADD-dTomato-Fishell-4hM3DqMammalian Expression, AAVpAAV Fishell
pAAV-mDlx-ChR2-mCherry-Fishell-3ChR2Mammalian Expression, AAVpAAV Fishell
pAAV-mDlx-GCaMP6f-Fishell-2GCaMP6fMammalian Expression, AAVpAAV Fishell
pAAV-mDlx-GFP-Fishell-1eGFPAAVpAAV Fishell
pX601-GFPGFP (Other)Mammalian Expression, AAVpX601GFP Kan
AAV-FLEX-CAG-CyRFP1CyRFP1 (Synthetic)Mammalian Expression, AAVpAAV-CAG-FLEX Double FLEXed Yasuda
pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2]Jaws-KGC-GFP-ER2 (Other)Mammalian Expression, AAVAAV with CAG promoter K200R W214F KGC, GFP, ER2 Boyden
pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2]Jaws-KGC-tdTomato-ER2 (Other)Mammalian Expression, AAVAAV with CAG promter K200R W214F KGC, ER2, tdTomato Boyden
pAAV-RAM-d2TTA::TRE-FLEX-tdTomato-WPREpAtdTomatoAAVDerived from AAV V032 T230I (please see depositor comments below) Lin
pAAV-RAM-d2TTA::TRE-ChR2-WPREpAChannelrhodopsin 2AAVDerived from AAV V032 H134R EYFP Lin
pAAV-RAM-d2TTA::TRE-ArchT-WPREpAArchTAAVDerived from AAV V032EGFP Lin
pAAV-RAM-d2TTA::TRE-NLS-mKate2-WPREpAmKate2AAVDerived from AAV V032Nuclear localization signal of SV40 large T antigen Lin
pAAV-Syn-FLEX-rc [ChrimsonR-GFP]ChrimsonR-GFP (Other)Mammalian Expression, AAVAAV-Syn-FLEX Chrimson K176R mutant GFP Boyden
pAAV-Syn-FLEX-rc [Chronos-tdTomato]Chronos-tdTomato (Other)Mammalian Expression, AAVAAV-Syn-FLEXtdTomato Boyden
pAAV-Syn-FLEX-fd [Chronos-GFP]Chronos-GFP (Other)Mammalian Expression, AAVAAV-Syn-FLEXGFP Boyden
pAAV-Syn-FLEX-fd [ChrimsonR-tdTomato]ChrimsonR-tdTomato (Other)Mammalian Expression, AAVAAV-Syn-FLEX Chrimson K176R mutant tdTomato Boyden
pAAV-CAG-FLEX-rc [Chronos-tdTomato]Chronos-tdTomato (Other)Mammalian Expression, AAVAAV with CAG promtertdTomato Boyden
pAAV-EF1α1.1-FLEX-rc [Chronos-GFP]Chronos-GFP (Other)Mammalian Expression, AAVAAV-Syn-FLEXGFP Boyden
V1-MESA-45F-M-tTAV1-MESA-45F-M-tTA (Homo sapiens)Mammalian Expression, AAVpAAVFlag Leonard
V1-MESA-45F-TevV1-MESA-45F-Tev (Homo sapiens)Mammalian Expression, AAVpAAVFlag Leonard
V2-MESA-35F-M-tTAV2-MESA-35F-M-tTA (Homo sapiens)Mammalian Expression, AAVpAAVFlag Leonard
V2-MESA-35F-TevV2-MESA-35F-Tev (Homo sapiens)Mammalian Expression, AAVpAAVFlag Leonard
pAAV-Sico-RedSico-Red (Other)AAVpAAV-MCSmCherry Hwang
pAav-MCS-PQS1-3xFLAGMulticloning sites and selection cassette (Mus musculus)AAVpAAV-MCS Eyckerman
pAav-TP53-PQS1-3xFLAGTP53 genomic region HR1 (Homo sapiens), TP53 genomic region HR2 (Homo sapiens)AAVpAav-MCS-PQS1-3xFLAGPQS1 3xFLAG Eyckerman
pAav-IQGAP1-PQS1-3xFLAGIQGAP1 genomic region HR1 (Homo sapiens), IQGAP1 genomic region HR2AAVpAAV-MCS-PQS1-3xFLAGPQS1 3xFLAG Eyckerman
pAav-MDM2-PQS2-3xHAMDM2 genomic sequence HR1 (Homo sapiens), MDM2 genomic insert HR2 (Homo sapiens)AAVpAav-MCS-PQS2-3xHAPQS2 3xHA Eyckerman
pAav-MCS-PQS2-3xHALOX-PGK-NEO-LOX (Mus musculus)AAVpAAV-MCSPQS2 3xHA Eyckerman
pK168.AAV-EF1α-DIO-tTA-P2A-RFP-WPRE (Supernova) RFP-P2A-tTA (Other)Mammalian Expression, AAVpAAV-Ef1a-DIO EYFP (Plasmid #27056) Iwasato
pK170.AAV-TRE-Cre-WPRE (Supernova)nlsCre-WPRE (Other)Mammalian Expression, AAVpAAV-TRE-MCS-WPRE Iwasato
pAAV-hSyn-FLEX-TVA-P2A-EGFP-2A-oGOptimized G Protein (Synthetic), Enhanced GFP (Synthetic), TVA (Gallus gallus)AAV, Cre/LoxpAAV-syn-FLEX-splitTVA-eGFP-B19G IW Naughton
pAAV hSyn1 bPAC cMyc T2A tDimerhumanized photoactivated adenylyl cyclase (Other), red fluorescent protein (Other)Mammalian Expression, AAVpAAVcMyc Tag Oertner
pAAV hSyn1 bPAC cMyc S27A 2A tDimerhumanized photoactivated adenylyl cyclase (Other), red fluorescent protein (Other)Mammalian Expression, AAVpAAV S27A cMyc Tag Oertner
pAAV CAG ChR2 E123T T159C 2A tDimerChannelrhodopsin-2 (Other), red fluorescent protein (Other)Mammalian Expression, AAVpAAV E123T , T159C Oertner
pAAV-RSV-SpCas9pRSV (Other)AAVpAAV Lei
AAV-shRNA_Tet3Tet3 (Mus musculus)Mammalian Expression, AAVAAVEYFP Song
AAV-shRNA-ctrlshRNA ctrl (Mus musculus)AAVAAVEYFP Song
AAV-shRNA-Tet1shRNA Tet1 (Mus musculus)AAVAAVEYFP Song
AAV-shRNA-Tet2shRNA Tet2 (Mus musculus)AAVAAVEYFP Song
AAV9:cTNT::3Flag-hYAP S127AYAP (Homo sapiens)AAVpAAV.cTNT. Serine 127 was mutated into Alanine, to activate YAP. 3Flag Pu
pAAV-AcGFP-progerinAcGFP-progerin (Homo sapiens)Mammalian Expression, AAVpAAV-MCS progerin sequence is LMNA gene with nucleotide C1824T mutation AcGFP Hewitt
pAAV-nEFCas9nEF-Cas9 (Synthetic)Mammalian Expression, AAV, CRISPRPX551HA-NLS Belmonte
pAAV-mTubb3U6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA (Synthetic)AAV, CRISPRPX551 Belmonte
pAAV-Ai14-HITIU6-Ai14sgRNA-GFPNLS-EF1a-mCherryKASH-pA (Synthetic)AAV, CRISPRPX551 Belmonte
pAAV-Ai14-lucU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA (Synthetic)AAV, CRISPR, LuciferasePX551 Belmonte
pAAV-rMERTK-HITIU6-rMertksgRNA-Mertk(intron1-2)-nEF-GFPKASH-pA (Synthetic)AAV, CRISPRPX551 Belmonte
AAV pEF1a-DIO-FLPo-WPRE-hGHpACre-dependent mouse codon-optimized Flp recombinase. (Mus musculus)Mammalian Expression, AAVpAAVN/A Zhang
AAV-U6gRNA1-U6gRNA2-TnT-CregRNA1 (Other), gRNA2 (Other), Cre (Other)AAVpAAV Pu
AAV-U6-sgRNA-hSyn-mCherrymCherryMammalian Expression, AAV, CRISPRpX552 Hewitt
pAAV-EF1a-FLuc-WPRE-HGHpAFirefly Luciferase (Other)AAVpAAV with AAV2 ITRs Kay
1179_pAAV-U6-BbsI-gRNA-CB-EmGFPEmGFP (Other)Mammalian Expression, AAV, CRISPRpEMBL8 Lagor
1183_pAAV-U6-Ex14-gRNAd-CB-EmGFPEmGFP (Other)Mammalian Expression, AAV, CRISPRpEMBL8 Lagor
1184_pAAV-U6-ApoB-gRNA2-CB-EmGFPEmGFP (Other)Mammalian Expression, AAV, CRISPRpEMBL8 Lagor
pOTTC1328 - pAAV EF1a HA-hM3D(Gq)HA-tagged hM3D(Gq)Mammalian Expression, AAVpAAV EF1a DIOHA Harvey
pOTTC1329 - pAAV EF1a HA-hM4D(Gi)HA-tagged hM4D(Gi)Mammalian Expression, AAVpAAV EF1a DIOHA Harvey
AAV-syn-ChR2-EYFP-KvChannelrhodopsin (Other)Mammalian Expression, AAVpAAV H134R EYFP Bolton
AAV-syn-ChR2-Kv-P2A-H2b-mRuby2Channelrhodopsin (Other), Histone 2B (Mus musculus)Mammalian Expression, AAVpAAV H134R mRuby2 Bolton
pAAV-IRES-hrGFP-mWnt3amouse Wnt3a (Mus musculus)AAVpAAV-IRES-hrGFPNone Takemaru
pAAV-IRES-hrGFP-mWnt5amouse Wnt5a (Mus musculus)AAVpAAV-IRES-hrGFP Takemaru
pAAV-hSYN-bArrestin2-TevC-P2A-TdTomato-WPRE-bGHpAbArrestin2-TevC-P2A-TdTomato (Synthetic)Mammalian Expression, AAVpAAV-MCS R173H in TdTomato (Please see depositor comments below) TdTomato Kwon
pAAV-hSYN-DRD2-V2tail-TevN-BLITz1-TetR-VP16-bGHpADRD2-V2tail-TevN-BLITz1-TetR-VP16 (Synthetic)Mammalian Expression, AAVpAAV-MCS short isoform of DRD2 (deletion of 242-270) FLAG Kwon
pAAV-TRE-EGFPtetO-EGFP (Synthetic)Mammalian Expression, AAVpAAV-MCS Kwon
pAAV-TRE-FLEX-eNpHR-EYFPeNpHR=EYFP (Synthetic)Mammalian Expression, AAVpAAV-MCSEYFP Kwon
CaMKIIP-mEGFP-P2A-paAIP2 (R5AR6A)/pAAVmEGFP-P2A-paAIP2(R5AR6A) (Synthetic)AAVpAAV-MCS Yasuda
pAAV-CBh-DIO-CB2-EGFPEGFP (Synthetic), type-2 cannabinoid receptor (Mus musculus)AAVpAAV-Ef1a-DIO-EGFP-WPRE-pANone, FLAG Kim
pAAV-U6-gRNA-CBh-mCherrymCherry (Synthetic)AAVAAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR Kim
pAAV-U6-CB2gRNA-CBh-mCherrymCherry (Synthetic)AAVAAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR Kim
pAAV-i53i53 (Synthetic)Mammalian Expression, AAVpAAV UbvG08 with I44A mutation and no terminal Glycines FLAG Durocher
pAAV-i53-DMi53-DM (Synthetic)Mammalian Expression, AAVpAAV UbvG08 with I44A, P69L, and L70V mutations and no terminal Glycines FLAG Durocher
TRE-mCherrymCherry (Synthetic)Mammalian Expression, AAVAAV vector Ting
TRE-ChrimsonR-mCherryChimsonR-mCherry (Synthetic)Mammalian Expression, AAVAAV vector Ting
Ca-FLARE (TF)NRX-TM-Nav1.6 -CaMbp(M2)-eLOV-TEVcs(ENLYFQ▲M)-tTA-VP16 (Synthetic)Mammalian Expression, AAVAAV vector Ting
Ca-FLARE (protease)CaM-V5-TEVp(Δ220-242) (Synthetic)Mammalian Expression, AAVAAV vector Ting
pZac2.1 GfaABC1D NAPA-A SV40Neuron-astrocyte proximity assay - Astrocyte (Synthetic)AAVpZac2.1 Khakh
pZac2.1 hSynapsin1 NAPA-N SV40Neuron-astrocyte proximity assay - Neuronal (Synthetic)AAVpZac2.1 Khakh
pZac2.1 hSynapsin1 FLEX NAPA-N SV40Neuron-astrocyte proximity assay - Neuronal (Synthetic)AAVpZac2.1 Khakh
pZac2.1 GfaABC1D hM3D mCherry SV40hM3D (Homo sapiens)AAVpZac2.1mCherry Khakh
pZac2.1 GfaABC1D rM3D mCherry SV40 rM3D (Rattus norvegicus)AAVpZac2.1mCherry Khakh
pZac2.1 GfaABC1D hM4D mCherry SV40 hM4D (Homo sapiens)AAVpZac2.1mCherry Khakh
pAnc80L65AAPAncestral AAV Capsid Anc80L65AAP (Synthetic)Mammalian Expression, AAV, Synthetic Biologysynthetic Vandenberghe
pAAV-M13-TEV-C-P2A-TdTomatoM13-TEV-C-P2A-TdTomato (Synthetic)Mammalian Expression, AAV, Synthetic BiologypSyc 171 P2A vectorTdTomato Kwon
pAAV-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTATM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Synthetic)Mammalian Expression, AAV, Synthetic BiologypAAV Kwon
pZac2.1 hSynapsin1 NAPA-N2 SV40extracellular membrane tethered fluorescent protein (Synthetic)AAVpZac2.1 Khakh
AAV_Efs_hSpCas9_NLS_FLAG-SV40humanized S. pyogenes Cas9 (Synthetic)Mammalian Expression, Mouse Targeting, AAVpAAVFlag Yang
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyAActb HMEJ donor (Synthetic)Mammalian Expression, Mouse Targeting, AAVpAAV Yang
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyAActb HR donor (Synthetic)Mammalian Expression, Mouse Targeting, AAVpAAV Yang
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyAActb NHEJ donor (Synthetic)Mammalian Expression, Mouse Targeting, AAVpAAV Yang
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyAActb MMEJ donor (Synthetic)Mammalian Expression, Mouse Targeting, AAVpAAV Yang
AAV_Actb MMEJ donorActb MMEJ donor (Synthetic)Mammalian Expression, Mouse TargetingpAAV Yang
AAV_Actb NHEJ donorActb NHEJ donor (Synthetic)Mammalian Expression, Mouse TargetingpAAV Yang
AAV_Actb HR donorActb HR donor (Synthetic)Mammalian Expression, Mouse TargetingpAAV Yang
AAV_Actb HMEJ donorActb HMEJ donor (Synthetic)Mammalian Expression, Mouse TargetingpAAV Yang
AAV_Cdx2 HMEJ donorCdx2 HMEJ donor (Synthetic)Mammalian Expression, Mouse TargetingpAAV Yang
AAV_Dbh HMEJ donorDbh HMEJ donor (Synthetic)Mammalian Expression, Mouse TargetingpAAV Yang
AAV_Nanog HMEJ donorNanog HMEJ donor (Synthetic)Mammalian Expression, Mouse TargetingpAAV Yang
AAV_Sox2 HMEJ donorSox2 HMEJ donor (Synthetic)Mammalian Expression, Mouse TargetingpAAV Yang
pAAVTREGCaMP6fGCaMP6f (Rattus norvegicus)Mammalian Expression, AAVpAAV Yamamori
pAAV_Thy1StTAtTA (Other)Mammalian Expression, AAVpAAV Yamamori
AAV2_hSyn_Phobos_CitrineSynthetic construct Phobos gene (Synthetic)Mammalian Expression, AAVpAAV2 T59S, E83N, E90Q, E101S, V117R, E123S, T159G, G163A, V242R, T246N, N258Q, E273S Citrine Wiegert
AAV2_hSyn_Aurora_CitrineSynthetic construct Aurora gene (Synthetic)Mammalian Expression, AAVpAAV2 V59S, E83N, E90Q, E101S, V117R, E123S, P242R, A246N, N258Q, E273S Citrine Wiegert
AAV2_hSyn_Phobos_CA_CitrineSynthetic construct Phobos_C128A gene (Synthetic)Mammalian Expression, AAVpAAV2 T59S, E83N, E90Q, E101S, V117R, E123S, C128A, T159G, G163A, V242R, T246N, N258Q, E273S Citrine Wiegert
AAV2_hSyn_Aurora_CA_CitrineSynthetic construct Aurora_C128A gene (Synthetic)Mammalian Expression, AAVpAAV2 V59S, E83N, E90Q, E101S, V117R, E123S, C128A, P242R, A246N, N258Q, E273S Citrine Wiegert
AAV2_hSyn_iChloC_CA_CitrineSynthetic construct iChloC_C128A gene (Synthetic)Mammalian Expression, AAVpAAV2 E83Q, E90R, E101S, C128A, T159C, D156N Citrine Wiegert
pAAV hSyn-Flex RG-ceruleanCerulean-E2A-RG (Other)AAVpAAV Ef1a flex C-RGcerulean Margrie
pAAV-IV-GFPL10GFPL10 (Mus musculus)Mammalian Expression, AAV, Cre/LoxpAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA L10: 2609 C->T to remove EcoRI site GFP Nectow
pAAV-FLEX-EGFPL10aEGFPL10a (Mus musculus)Mammalian Expression, AAV, Cre/LoxpAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpAGFP Schmidt
pAAV.CAG.Ruby2sm-Flag.WPRE.SV40 Ruby2-smFP-Flag (Synthetic)Mammalian Expression, AAVpAAV Looger
pAAV.CAG.GFPsm-myc.WPRE.SV40 GFP-smFP-myc (Synthetic)Mammalian Expression, AAVpAAV Looger
pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 GFP-smFP-myc (Synthetic)Mammalian Expression, AAVpAAV Looger
pAAV.CAG.Flex.Ruby2sm-Flag.WPRE.SV40 Ruby2-smFP-Flag (Synthetic)Mammalian Expression, AAVpAAV Looger
pAAV.hSyn.iGluSnFr.WPRE.SV40 iGluSnFr (Synthetic)Mammalian Expression, AAVpAAV Looger
pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 iGluSnFr (Synthetic)Mammalian Expression, AAVpAAV Looger
pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 iGluSnFr (Synthetic)Mammalian Expression, AAVpAAV Looger
pAAV.CAG.Flex.iGluSnFr.WPRE.SV40iGluSnFr (Synthetic)Mammalian Expression, AAVpAAV Looger
pAAV-CamKII-ArchT-GFP (PV2527)ArchT-GFP (Other)Mammalian Expression, AAVAAV with CaMKII promoterGFP Boyden
pAAV-TRE-mTurquoise2mTurquoise2 (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-TRE-mRuby2mRuby2 (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-TRE-DIO-mTurquoise2DIO-mTurquoise2 (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-TRE-DIO-tdTomatoDIO-tdTomato (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-TRE-DIO-mRuby2DIO-mRuby2 (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-CAG-tTAtTA (Other)Mammalian Expression, AAVpAAV *(see below) Gradinaru
pAAV-hSyn1-tTAtTA (Other)Mammalian Expression, AAVpAAV *(see below) Gradinaru
pAAV-ihSyn1-tTAtTA (Other)Mammalian Expression, AAVpAAV *(see below) Gradinaru
pAAV-ihSyn1-DIO-tTADIO-tTA (Other)Mammalian Expression, AAVpAAV *(see below) Gradinaru
pAAV-CAG-mTurquoise2mTurquoise2 (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-CAG-mRuby2mRuby2 (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-hSyn1-mTurquoise2mTurquoise2 (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-hSyn1-mRuby2mRuby2 (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-mTH-GFPGFP (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-GFAP-mKate2.5fmKate2.5f (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-mDlx-NLS-mRuby2NLS-mRuby2 (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-TRE-mNeonGreenmNeonGreen (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-TRE-DIO-mNeonGreenDIO-mNeonGreen (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-CAG-fDIO-mNeonGreenfDIO-mNeonGreen (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-CAG-mNeonGreenmNeonGreen (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-hSyn1-mNeonGreenmNeonGreen (Other)Mammalian Expression, AAVpAAV Gradinaru
pAAV-CaMKII-ChrimsonR-tdTomatoChrimsonR-tdTomato (Other)Mammalian Expression, AAVAAV-CaMKII Chrimson K176R mutant tdTomato Boyden
pAAV-CAG-Chronos-GFPChronos-GFP (Other)Mammalian Expression, AAVAAV with CAG promterGFP Boyden
pAAV-CAG-Jaws-KGC-GFP-ER2Jaws-KGC-GFP-ER2 (Other)Mammalian Expression, AAVAAV with CAG promter K200R W214F KGC, GFP, ER2 Boyden
AAV pCAG-FLEX-mRuby3-WPREmRuby3 (Synthetic)AAV, Cre/LoxAAV pCAG-FLEX-tdTomato-WPRE (Addgene #51503) Larsen
AAV pCAG-FLEX-mScarlet-WPREmScarlet (Synthetic)AAV, Cre/LoxAAV pCAG-FLEX-tdTomato-WPRE (Addgene #51503) Larsen
pAAV-dSa-VPRdCas9 (Synthetic)AAVpAAV (pUC f1) dead Cas9 VP64-p65-RTA activator Church
pAAV-dSa-VP64-p65(100-261)-RTA(125-190)dCas9 (Synthetic)AAVpAAV (pUC f1) dead Cas9 VP64-p65(101-261)-RTA(125-190) Church
pAAV-dSa-VP64dCas9 (Synthetic)AAVpAAV (pUC f1) dead Cas9 VP64 Church
pAAV-SCP1-dSa-VPR mini.dCas9 (Synthetic)AAVpAAV (pUC f1) dead Cas9 VPR mini Church
pAAV-EFS-dSa-VPR mini.dCas9 (Synthetic)AAVpAAV (pUC f1) dead Cas9 VPR mini Church
pAAV-CMV-dSa-VPR mini.-1X snRP1dCas9 (Synthetic)AAVpAAV (pUC f1) dead Cas9 VPR mini Church
pAAV-CMV-dSa-VPR mini.-2X snRP1dCas9 (Synthetic)AAVpAAV (pUC f1) dead Cas9 VPR mini Church
pAAV-CMV-dSa-VPR mini.-syn pAdCas9 (Synthetic)AAVpAAV (pUC f1) dead Cas9 VPR mini Church
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1dCas9 and gRNA targeting Actc1 (Synthetic)AAV, CRISPRpAAV (pUC f1) dead Cas9 VPR mini Church
pAAV-CMV-dSa VP64 Actc1dCas9 and gRNA targeting Actc1 (Synthetic)AAV, CRISPRpAAV (pUC f1) dead Cas9 VP64 Church
pAAV-SCP1-dSa VPR mini.-2X snRP-1 HbbdCas9 and gRNA targeting Hbb (Synthetic)AAVpAAV (pUC f1) dead Cas9 VPR mini Church
pAAV-CMV-dSa VP64 HbbdCas9 and gRNA targeting Hbb (Synthetic)AAV, CRISPRpAAV (pUC f1) dead Cas9 VP64 Church
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2dCas9 and gRNA targeting Actc1 (Synthetic)AAV, CRISPRpAAV (pUC f1) dead Cas9 VPR mini Church
pAAV-CMV-dSa VP64 Neurog2dCas9 and gRNA targeting Neurog2 (Synthetic)AAV, CRISPRpAAV (pUC f1) dead Cas9 VP64 Church
pAAV-SCP1-dSa VPR mini.-2X snRP-1 AfpdCas9 and gRNA targeting Afp (Synthetic)AAVpAAV (pUC f1) dead Cas9 VPR mini Church
pAAV-CMV-dSa VP64 AfpdCas9 and gRNA targeting Afp (Synthetic)AAV, CRISPRpAAV (pUC f1) dead Cas9 VP64 Church
pAAV-SCP1-dSa VPR mini.-2X snRP-1 BsaI gRNAAAVpAAV (pUC f1) Church
Icam 2 SaCas9 YAP sgRNA1SaCas9 gRNA targeting Yap1 (Mus musculus)Mammalian Expression, AAV, CRISPRpX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591) Huang
Icam 2 SaCas9 YAP sgRNA2SaCas9 gRNA targeting Yap1 (Mus musculus)Mammalian Expression, AAV, CRISPRpX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591) Huang
Icam 2 SaCas9 YAP sgRNA3SaCas9 gRNA targeting Yap1 (Mus musculus)Mammalian Expression, AAV, CRISPRpX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA Huang
Syn-ChR-tdTomatoChR2(H134R)-tdTomato (Other)Mammalian Expression, AAVpAAV ChR2(H134R), carrying a single point mutation at position H134, the native histidine residue is replaced by a more basic arginine. tdTomato Shepherd
pAAV.CBA.loxP.ArcLightD.2A.nlsmCherry.loxP.WPRE.SV40ArcLightD (Synthetic)Mammalian Expression, AAVpAAV2A-mCherry Cohen
pAAV.hSynap.ArcLightD.WPRE.SV40ArcLightD (Synthetic)Mammalian Expression, AAVpAAV Pieribone
pENN.AAV.hSynap.Flex.ArcLightDco.WPRE.SV40ArcLightDco (Synthetic)Mammalian Expression, AAVpENN.AAV Pieribone
pAAV.CAG.Flex.Twitch2B.WPRE.SV40Twitch2B (Synthetic)Mammalian Expression, AAVpAAV Griesbeck
pAAV.hSyn1.Twitch2B.WPRE.SV40Twitch2B (Synthetic)Mammalian Expression, AAVpAAV Griesbeck
pAAV.synP.DIO.EGFP.WPRE.hGHEGFP (Other)Mammalian Expression, AAVpAAV Wickersham
pAAV.CAG.LSL.EGFPEGFP (Other)Mammalian Expression, AAV, Cre/LoxpAAV-MCS Zeng
pAAV.CAG.LSL.tdTomatotdtomatoMammalian Expression, AAV, Cre/LoxpAAV-MCS Zeng
pAAV.hSynap.ChETA(E123T/H134R)-eYFP.WPRE.hGH hChR2(E123T/H134R) (Synthetic)Mammalian Expression, AAVpAAV humanized, E123T/H134R EYFP Deisseroth
pAAV.CaMKIIa.ChETA(E123T/H134R)-eYFP.WPRE.hGHhChR2(E123T/H134R) (Synthetic)Mammalian Expression, AAVpAAV humanized, E123T/H134R EYFP Deisseroth
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40channelrhodopsin-2 (Other)Mammalian Expression, AAVpAAV H134R mutation in ChR2 mCherry Deisseroth
pAAV.EF1a.ChR2-YFP.WPRE.hGHChR2 (Other)Mammalian Expression, AAVpAAVEYFP Deisseroth
pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry (PV2670)ChR1-VChR1 Chimera (Synthetic)Mammalian Expression, AAVpAAV E122T and E162T mCherry Deisseroth
pAAV-U6sgp53-U6sgbbSapI-GFAPCreMammalian Expression, Mouse Targeting, AAV, CRISPR, Synthetic BiologypAAV Chen
pAAV-U6sgp53-mTSG-GFAPCreGFAP promoter (Homo sapiens)Mammalian Expression, Mouse Targeting, AAV, CRISPR, Synthetic BiologypAAV Chen
pAAV-syn-FLEX-splitTVA-EGFP-tTATVA, EGFP, tet transactivator (Synthetic)Mammalian Expression, AAVpAAV Wickersham
pAAV-TREtight-mTagBFP2-B19GmTagBFP2 and rabies virus SAD B19 strain glycoprotein genes (B19G) (Synthetic)Mammalian Expression, AAVpAAV Wickersham
pENN.AAV.CAG.Flex.CaMPARI.WPRE.SV40CaMPARI (Synthetic)Mammalian Expression, AAVpAAV Looger
pAAV.hSyn.CaMPARI.WPRE.SV40CaMPARI (Synthetic)Mammalian Expression, AAVpAAV Looger
pAAV.Syn.Flex.GCaMP6f.WPRE.SV40GCaMP6f (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-T302L R303P A317E D380Y T381R S383T R392G Kim
pENN.AAV.CamKII.GCaMP6f.WPRE.SV40GCaMP6f (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-T302L R303P A317E D380Y T381R S383T R392G Wilson
pAAV.CAG.Flex.GCaMP6f.WPRE.SV40GCaMP6f (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-T302L R303P A317E D380Y T381R S383T R392G Kim
pAAV.CAG.GCaMP6f.WPRE.SV40GCaMP6f (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-T302L R303P A317E D380Y T381R S383T R392G Kim
pAAV.Syn.GCaMP6f.WPRE.SV40GCaMP6f (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-T302L R303P A317E D380Y T381R S383T R392G Kim
pAAV.Syn.Flex.GCaMP6m.WPRE.SV40GCaMP6m (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-T302L R303P M378G K379S D380Y T381R S383T R392G Kim
pAAV.CAG.Flex.GCaMP6m.WPRE.SV40GCaMP6m (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-T302L R303P M378G K379S D380Y T381R S383T R392G Kim
pAAV.CAG.GCaMP6m.WPRE.SV40GCaMP6m (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-T302L R303P M378G K379S D380Y T381R S383T R392G Kim
pAAV.Syn.GCaMP6m.WPRE.SV40GCaMP6m (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-T302L R303P M378G K379S D380Y T381R S383T R392G Kim
pAAV.CAG.Flex.GCaMP6s.WPRE.SV40GCaMP6s (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-K78H T302L R303P D380Y T381R S383T R392G Kim
pAAV.Syn.GCaMP6s.WPRE.SV40GCaMP6s (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-K78H T302L R303P D380Y T381R S383T R392G Kim
pAAV.CAG.GCaMP6s.WPRE.SV40GCaMP6s (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-K78H T302L R303P D380Y T381R S383T R392G Kim
pAAV.Syn.Flex.GCaMP6s.WPRE.SV40GCaMP6s (Synthetic)Mammalian Expression, AAVpAAV GCaMP3-K78H T302L R303P D380Y T381R S383T R392G Kim
pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40jRCaMP1a (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.Syn.NES.jRCaMP1a.WPRE.SV40jRCaMP1a (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40jRCaMP1b (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40jRCaMP1b (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.Syn.NES-jRCaMP1b.WPRE.SV40jRCaMP1b (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.CAG.Flex.NES-jRGECO1a.WPRE.SV40jRGECO1a (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40jRGECO1a (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.Syn.NES-jRGECO1a.WPRE.SV40jRGECO1a (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.CAG.Flex.NES-jRGECO1b.WPRE.SV40jRGECO1b (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.Syn.Flex.NES-jRGECO1b.WPRE.SV40jRGECO1b (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.Syn.NES-jRGECO1b.WPRE.SV40 jRGECO1b (Synthetic)Mammalian Expression, AAVpAAV Kim
pAAV.GfaABC1D.GluSnFr.SV40GluSnFr (Synthetic)Mammalian Expression, AAVpAAV Khakh
pAAV.GFA104.PI.eGFP.WPRE.bGHEGFP (Other)Mammalian Expression, AAVpAAV Haydon
pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40CaMPARI2 (Synthetic)AAVpAAVNES_his, FLAG-HA-myc Schreiter
pAAV_hsyn_NES-his-CaMPARI2-F391W-WPRE-SV40CaMPARI2-F391W (Synthetic)AAVpAAVNES_his, FLAG-HA-myc Schreiter
pAAV_hsyn_NES-his-CaMPARI2-H396K-WPRE-SV40CaMPARI2-H396K (Synthetic)AAVpAAVNES_his, FLAG-HA-myc Schreiter
pAAV_hsyn_NES-his-CaMPARI2-F391W-G395D-WPRE-SV40CaMPARI2_F391W-G395D (Synthetic)AAVpAAVNES_his, FLAG-HA-myc Schreiter
pAAV_hsyn_NES-his-CaMPARI2-L398T-WPRE-SV40CaMPARI2_L398T (Synthetic)AAVpAAVNES_his, FLAG-HA-myc Schreiter
pAAV-CaMKII-ASAP2sASAP2s (Synthetic)Mammalian Expression, AAVpAAV St-Pierre
pAAV-hSyn-ASAP2sASAP2s (Synthetic)Mammalian Expression, AAVpAAV St-Pierre
pAAV hSyn1 ChR2 ET-TC 2A tDimerChannelrhodopsin-2 (Other), synaptophysin-red fluorescent protein (Other)Mammalian Expression, AAVpAAV E123T , T159C Oertner
AAV-hSynI-rtTAV16rtTAV16 (Other)Mammalian Expression, AAVpAAV rtTA variant reported in Gene Therapy (2006) 13, 1382–1390 Yamamori
pAAV-EF1a-FLEX-T-RGTVA E2A-RG (Synthetic)Mammalian Expression, AAVpGTB Addgene 26197 Margrie
GfaABC1D-cyto-iATPSnFR1.0iATPSnFR1.0AAVpZAC Khakh
GfaABC1D-cyto-Ruby3-iATPSnFR1.0mRuby3-iATPSnFR1.0AAVpZAC Khakh
Synapsin-pm-iATPSnFR1.0iATPSnFR1.0AAVpsynapsin Khakh
Synapsin-cyto-iATPSnFR1.0iATPSnFR1.0AAVpsynapsin Khakh
Synapsin-cyto-mRuby3-iATPSnFR1.0mRuby3-iATPSnFR1.0AAVpsynapsinRuby3 Khakh
pAAV-CamKIIa-ChrimsonR::FusionRed::Kv2.1ChrimsonR::FusionRed::Kv2.1 (Other)AAVpAAVFusionRed, Kv2.1 traficking domain Svoboda
pAAV-CamKIIa-C1V1::FusionRed::Kv2.1C1V1::FusionRed::Kv2.1 (Other)AAVpAAVFusionRed, Kv2.1 traficking domain Svoboda
pAAV-CMV-FLEX-TVAmCherry-2A-oGTVA-mCherry fusion protein after CRE-mediated recombination, Optimised Rabies Glycoprotein (oG) after CRE-mediated recombinationAAV ; Adeno Associated Viral VectorpAAV Tripodi
pAAV-CMV-FRT-myrSNAP-2A-H2BeGFP-WPREmembrane-targeted SNAP protein after FLP-mediated recombination, Nuclear-targeted eGFP after FLP-mediated recombinationAAV ; Adeno Associated Viral VectorpAAV Tripodi
pAAV-synp-F-H2B-GCaMP6fH2B-GCaMP6f (Homo sapiens)Mammalian Expression, AAVpAAV Cox
pAAV-synp-F-H2B-jRGECO1aH2B-jRGECO1a (Homo sapiens)Mammalian Expression, AAVpAAV Cox
pUCmini-iCAP-PHP.BSynthetic construct isolate AAV-PHP.B VP1 gene (Synthetic)Mammalian Expression, AAVpUC57-mini Gradinaru
pUCmini-iCAP-PHP.B2Synthetic construct isolate AAV-PHP.B2 VP1 gene (Synthetic)Mammalian Expression, AAVpUC57-mini Gradinaru
pUCmini-iCAP-PHP.B3Synthetic construct isolate AAV-PHP.B3 VP1 gene (Synthetic)Mammalian Expression, AAVpUC57-mini Gradinaru
pUCmini-iCAP-PHP.eBSynthetic construct isolate AAV-PHP.eB VP1 gene (Synthetic)Mammalian Expression, AAVpUC57-mini Gradinaru
pUCmini-iCAP-PHP.SSynthetic construct isolate AAV-PHP.S VP1 gene (Synthetic)Mammalian Expression, AAVpUC57-mini Gradinaru
pAAV-GFAP-2xNLS-mTurquoise22xNLS-mTurquoise2 (Other)AAVpAAVNLS Gradinaru
pAAV-MBP-2xNLS-tdTomato2xNLS-tdTomato (Other)AAVpAAVNLS Gradinaru
pAAV-CAG-eYFPEYFP (Other)AAVpAAV Gradinaru
pAAV-TRE-eYFPEYFP (Other)AAVpAAV Gradinaru
pAAV-TRE-DIO-eYFP-fEYFP-f (Other)AAVpAAV Gradinaru
CAG-DIO-mRuby2mRuby2 (Other)AAVpAAV Gradinaru
CAG-DIO-mTurquoise2mTurquoise2 (Other)AAVpAAV Gradinaru
hSyn1-tdTomatoftdTomato (Other)AAVpAAV Gradinaru
pAAV-Syn1-tTAtTA2 (Other)AAVAAV2 Imai
pAAV-TRE-mTurquoise2-WPREmTurquoise2 (Other)AAVAAV2 Imai
pAAV-TRE-tdTomato-WPREtdTomato (Other)AAVAAV2 Imai
pAAV-CMV-TVAmCherry-2A-oGTVA-mCherry fusion protein, Optimised Rabies Glycoprotein (oG)AAV ; Adeno Associated Viral VectorpAAV Tripodi
pEMS2143ssAAV-smCBA-EmGFP-WPRE (Synthetic)AAVAAV2 Simpson
pEMS2144ssAAV-smCBA-EmGFP (Synthetic)AAVAAV2 Simpson
AAV-FLEX-mCherry-FHA1-subT391A-mCherrymCherry-subT391A-FHA1-mCherry (Synthetic)AAVAAV-FLEXmCherry Sabatini
pGP-AAV-syn-jGCaMP7s-WPREjGCaMP7s (Rattus norvegicus)Mammalian Expression, AAVAAV-SynT7 epitope, Xpress tag, 6xHis Kim
pGP-AAV-syn-jGCaMP7f-WPREjGCaMP7f (Rattus norvegicus)Mammalian Expression, AAVAAV-SynT7 epitope, Xpress tag, 6xHis Kim
pGP-AAV-syn-jGCaMP7b-WPREjGCaMP7b (Rattus norvegicus)Mammalian Expression, AAVAAV-SynT7 epitope, Xpress tag, 6xHis Kim
pGP-AAV-syn-FLEX-jGCaMP7s-WPREjGCaMP7s (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxAAV-Syn-FLEXT7 epitope, Xpress tag, 6xHis Kim
pGP-AAV-syn-FLEX-jGCaMP7f-WPREjGCaMP7f (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxAAV-Syn-FLEXT7 epitope, Xpress tag, 6xHis Kim
pGP-AAV-syn-FLEX-jGCaMP7b-WPREjGCaMP7b (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxAAV-Syn-FLEXT7 epitope, Xpress tag, 6xHis Kim
pGP-AAV-CAG-FLEX-jGCaMP7s-WPREjGCaMP7s (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxAAV-CAG-FLEXT7 epitope, Xpress tag, 6xHis Kim
pGP-AAV-CAG-FLEX-jGCaMP7f-WPREjGCaMP7f (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxAAV-CAG-FLEXT7 epitope, Xpress tag, 6xHis Kim
pGP-AAV-CAG-FLEX-jGCaMP7b-WPREjGCaMP7b (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxAAV-CAG-FLEXT7 epitope, Xpress tag, 6xHis Kim
pAAV-EFS-SpCas9Streptococcus pyogenes Cas9 (Synthetic)Mammalian Expression, AAV, CRISPRPX551Myc Yasuda
pAAV-HDR-mEGFP-camk2acalcium/calmodulin-dependent protein kinase II alpha (Mus musculus)Mouse Targeting, AAV, CRISPRPX551 Yasuda
pAAV-UAS-CITRINECitrine (Synthetic)Mammalian Expression, AAVpAAV Ting
pAAV-UAS-LuciferaseLuciferase (Synthetic)Mammalian Expression, AAVpAAV Ting
pAAV-b2AR-eLOV-TEVcs-FLAG-GAL4-V5b2AR-eLOV-TEVcs-FLAG-GAL4-V5 (Synthetic)Mammalian Expression, AAVpAAV Ting
pAAV-NMBR-eLOV-TEVcs-FLAG-GAL4-V5NMBR-eLOV-TEVcs-FLAG-GAL4-V5 (Synthetic)Mammalian Expression, AAVpAAV Ting
pAAV-AVPR2-eLOV-TEVcs-FLAG-GAL4-V5AVPR2-eLOV-TEVcs-FLAG-GAL4-V5 (Synthetic)Mammalian Expression, AAVpAAV Ting
pAAV-beta-arrestin2-HA-TEV219beta-arrestin2-HA-TEV219 (Synthetic)Mammalian Expression, AAVpAAV Ting
pAAV2/2Rep2/Cap2 (Other)Mammalian Expression, AAVpUC19 with additional elements Fan
pAAV2/5Rep2/Cap5 (Other)Mammalian Expression, AAVpUC19 with additional elements Fan
pGP-AAV-syn-jGCaMP7c variant 1513-WPREjGCaMP7c variant 1513 (Rattus norvegicus)Mammalian Expression, AAVAAV-SynT7 epitope, Xpress tag, 6xHis Kim
pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPREjGCaMP7c variant 1513 (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxAAV-Syn-FLEXT7 epitope, Xpress tag, 6xHis Kim
pGP-AAV-CAG-FLEX-jGCaMP7c variant 1513-WPREjGCaMP7c variant 1513 (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxAAV-CAG-FLEXT7 epitope, Xpress tag, 6xHis Kim
pAAV-hSyn-DIO-ChrimsonR-mRuby2-STChrimsonR-mRuby2-STAAVpAAV K176R in Chrimson soma targeting motif, mRuby2 Adesnik
pAAV.CMV.PI.EGFP.WPRE.bGHEGFP (Other)Mammalian Expression, AAVpAAV Wilson
pAAV.CMV.LacZ.bGHLacZ (Other)Mammalian Expression, AAVpAAV Wilson
pAAV.CMV.ffLuciferase.SV40Luciferase (Other)Mammalian Expression, AAV, LuciferasepAAV Wilson
pAAV.CMV.Luc.IRES.EGFP.SV40Luciferase (Other)Mammalian Expression, AAV, LuciferasepAAVIRES-GFP Wilson
pAAV.TBG.PI.LacZ .bGHLacZ (Other)Mammalian Expression, AAVpAAV Wilson
pAAV.TBG.PI.eGFP.WPRE.bGHEGFP (Other)Mammalian Expression, AAVpAAV Wilson
pAAV.TBG.PI.Null.bGHNone (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.CMVs.Pl.Cre.rBGCre (Other)Mammalian Expression, AAV, Cre/LoxpAAV Wilson
pENN.AAV.TBG.PI.ffLuciferase.RBGLuciferase (Other)Mammalian Expression, AAV, LuciferasepAAV Wilson
pAAV.hSyn.eGFP.WPRE.bGHEGFP (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40EGFP-Cre (Other)Mammalian Expression, AAV, Cre/LoxpAAV Wilson
pENN.AAV.CamKII0.4.eGFP.WPRE.rBGEGFP (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.CB7.CI.eGFP.WPRE.rBGEGFP (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.cTNT.PI.eGFP.WPRE.rBGcTNT-PI-EGFP (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.CB7.CI.mCherry.WPRE.RBGCB7-CI-mCherry (Other)Mammalian Expression, AAVpAAV Wilson
pAAV.CMV.HI.eGFP-Cre.WPRE.SV40EGFP-Cre (Other)Mammalian Expression, AAV, Cre/LoxpAAV Wilson
pENN.AAV.CB7.CI.TurboRFP.WPRE.RBGCB7-CI-TurboRFP (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.EF1a.eGFP.WPRE.rBGEGFP (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.CMVs.TurboRFP.WPRE.RBGTurboRFP (Other)Mammalian Expression, AAVpAAV Wilson
pAAV.GFAP.eGFP.WPRE.hGHeGFP (Other)Mammalian Expression, AAVpAAV Wilson
pAAV.GFAP.Cre.WPRE.hGHCre (Other)Mammalian Expression, AAV, Cre/LoxpAAV Wilson
pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40EGFP-Cre (Other)Mammalian Expression, AAV, Cre/LoxpAAV Wilson
pENN.AAV.hSyn.TurboRFP.WPRE.RBGTurboRFP (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.hSyn.Cre.WPRE.hGHCre (Other)Mammalian Expression, AAV, Cre/LoxpAAV Wilson
pENN.AAV.CAG.tdTomato.WPRE.SV40tdtomato (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.hSyn.Cre.hGHCre (Other)Mammalian Expression, AAV, Cre/LoxpAAV Wilson
pENN.AAV.tMCK.PI.eGFP.WPRE.bGHEGFP (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.CB7.CI.mCerulean.WPRE.RBGmCerulean (Other)Mammalian Expression, AAVpAAV Wilson
pENN.AAV.CamKII 0.4.Cre.SV40Cre (Other)Mammalian Expression, AAV, Cre/LoxpAAV Wilson
pAAV.GfaABC1D.PI.Lck-GFP.SV40Lck-EGFP (Other)Mammalian Expression, AAVpZac2.1 Khakh
pAAV.GfaABC1D.PI.Cre.SV40Cre (Other)Mammalian Expression, AAV, Cre/LoxpAAV Khakh
pAAV.CamKII(1.3).eYFP.WPRE.hGHEYFP (Other)Mammalian Expression, AAVpAAV Deisseroth
pAAV-CKIIa-stGtACR2-FusionRedstGtACR2 (Synthetic)Mammalian Expression, AAVpAAVFusionRed, Kv2.1 Yizhar
pAAV_hSyn1-SIO-stGtACR2-FusionRedstGtACR2 (Synthetic)Mammalian Expression, AAVpAAVFusionRed, Kv2.1 Yizhar
pAAV_hSyn1-SIO-stGtACR1-FusionRedstGtACR1 (Synthetic)Mammalian Expression, AAVpAAVFusionRed, Kv2.1 Yizhar
pAAV-CKIIa-stGtACR1-FusionRedstGtACR1 (Synthetic)Mammalian Expression, AAVpAAVFusionRed, Kv2.1 Yizhar
pAAV-Ef1a-fDIO-GCaMP6sGCaMP6s (Rattus norvegicus)Mammalian Expression, AAV ; Flp/FrtpAAV-Ef1a-fDIO hChR2(H134R)-EYFP Larsen
pAAV-Ef1a-DIO-Synaptophysin-GCaMP6ssynaptophysin-GCaMP6s (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxpAAV-EF1a-Flpo Larsen
AAV-CAG-FLPX-rc [Chronos-tdTomato]Chronos-tdTomato (Synthetic)Mammalian Expression, AAVAAV-CAG-FLPXtdTomato (codon diversified version) Boyden
pUCM-AAVS1-TO-hNGN2Neurogenin 2 (Homo sapiens), mCherry (Synthetic), rtTA3G (Other)CRISPR, TALENpUCM Ward
pAAV-CBh-mKate2-IRES-MCS (WT-WT)mKate2, IRES-Multiple cloning siteAAVpAAV codon optimized Patrick
pAAV-CBh-mKate2-IRES-MCS (C-gap-WT)mKate2, IRES-Multiple cloning siteAAVpAAV codon optimized Patrick
pAAV.hSynapsin.SF-iGluSnFR.A184SSF-iGluSnFR.A184S (Synthetic)AAVpAAV.hSynapsin GltI: A184S Looger
pAAV.hSynapsin.SF-iGluSnFR.A184VSF-iGluSnFR.A184V (Synthetic)AAVpAAV.hSynapsin GltI: A184V Looger
pAAV.hSynapsin.SF-iGluSnFR.S72ASF-iGluSnFR.S72A (Synthetic)AAVpAAV.hSynapsin GltI: S72A Looger
pAAV.hSynapsin.SF-Venus-iGluSnFR.A184SSF-Venus-iGluSnFR.A184S (Synthetic)AAVpAAV.hSynapsin SFGFP: T203Y, F46L, T65G, S72A GltI: A184S Looger
pAAV.hSynapsin.SF-Venus-iGluSnFR.A184VSF-Venus-iGluSnFR.A184V (Synthetic)AAVpAAV.hSynapsin SFGFP: T203Y, F46L, T65G, S72A GltI: A184V Looger
pAAV.hSynapsin.SF-Venus-iGluSnFR.S72ASF-Venus-iGluSnFR.S72A (Synthetic)AAVpAAV.hSynapsin SFGFP: T203Y, F46L, T65G, S72A GltI: S72A Looger
pAAV.hSynap-FLEX.SF-iGluSnFR.A184SSF-iGluSnFR.A184S (Synthetic)AAVpAAV.hSynapsin-FLEX GltI: A184S Looger
pAAV.hSynap-FLEX.SF-iGluSnFR.A184VSF-iGluSnFR.A184V (Synthetic)AAVpAAV.hSynapsin-FLEX GltI: A184V Looger
pAAV.hSynap-FLEX.SF-iGluSnFR.S72ASF-iGluSnFR.S72A (Synthetic)AAVpAAV.hSynapsin-FLEX GltI: S72A Looger
pAAV.hSynap-FLEX.SF-Venus-iGluSnFR.A184SSF-Venus-iGluSnFR.A184S (Synthetic)AAVpAAV.hSynapsin-FLEX SFGFP: T203Y, F46L, T65G, S72A GltI: A184S Looger
pAAV.hSynap-FLEX.SF-Venus-iGluSnFR.A184VSF-Venus-iGluSnFR.A184V (Synthetic)AAVpAAV.hSynapsin-FLEX SFGFP: T203Y, F46L, T65G, S72A GltI: A184V Looger
pAAV.hSynap-FLEX.SF-Venus-iGluSnFR.S72ASF-Venus-iGluSnFR.S72A (Synthetic)AAVpAAV.hSynapsin-FLEX SFGFP: T203Y, F46L, T65G, S72A GltI: S72A Looger
pAAV.CAG-FLEX.SF-iGluSnFR.A184SSF-iGluSnFR.A184S (Synthetic)AAVpAAV.CAG-FLEX GltI: A184S Looger
pAAV.CAG-FLEX.SF-iGluSnFR.A184VSF-iGluSnFR.A184V (Synthetic)AAVpAAV.CAG-FLEX GltI: A184V Looger
pAAV.CAG-FLEX.SF-iGluSnFR.S72ASF-iGluSnFR.S72A (Synthetic)AAVpAAV.CAG-FLEX GltI: S72A Looger
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.A184SSF-Venus-iGluSnFR.A184S (Synthetic)AAVpAAV.CAG-FLEX SFGFP: T203Y, F46L, T65G, S72A GltI: A184S Looger
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.A184VSF-Venus-iGluSnFR.A184V (Synthetic)AAVpAAV.CAG-FLEX SFGFP: T203Y, F46L, T65G, S72A GltI: A184V Looger
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.S72ASF-Venus-iGluSnFR.S72A (Synthetic)AAVpAAV.CAG-FLEX SFGFP: T203Y, F46L, T65G, S72A GltI: S72A Looger
pAAV.GFAP.SF-iGluSnFR.A184SSF-iGluSnFR.A184S (Synthetic)AAVpAAV.GFAP GltI: A184S Looger
pAAV.GFAP.SF-iGluSnFR.A184VSF-iGluSnFR.A184V (Synthetic)AAVpAAV.GFAP GltI: A184V Looger
pAAV.GFAP.SF-iGluSnFR.S72ASF-iGluSnFR.S72A (Synthetic)AAVpAAV.GFAP GltI: S72A Looger
pAAV.GFAP.SF-Venus-iGluSnFR.A184SSF-Venus-iGluSnFR.A184S (Synthetic)AAVpAAV.GFAP SFGFP: T203Y, F46L, T65G, S72A GltI: A184S Looger
pAAV.GFAP.SF-Venus-iGluSnFR.A184VSF-Venus-iGluSnFR.A184V (Synthetic)AAVpAAV.GFAP SFGFP: T203Y, F46L, T65G, S72A GltI: A184V Looger
pAAV.GFAP.SF-Venus-iGluSnFR.S72ASF-Venus-iGluSnFR.S72A (Synthetic)AAVpAAV.GFAP SFGFP: T203Y, F46L, T65G, S72A GltI: S72A Looger
pAAV.CAG.SF-iGluSnFR.A184SSF-iGluSnFR.A184S (Synthetic)AAVpAAV.CAG GltI: A184S Looger
pAAV.CAG.SF-iGluSnFR.A184VSF-iGluSnFR.A184V (Synthetic)AAVpAAV.CAG GltI: A184V Looger
pAAV.CAG.SF-iGluSnFR.S72ASF-iGluSnFR.S72A (Synthetic)AAVpAAV.CAG GltI: S72A Looger
pAAV.CAG.SF-Venus-iGluSnFR.A184SSF-Venus-iGluSnFR.A184S (Synthetic)AAVpAAV.CAG SFGFP: T203Y, F46L, T65G, S72A GltI: A184S Looger
pAAV.CAG.SF-Venus-iGluSnFR.A184VSF-Venus-iGluSnFR.A184V (Synthetic)AAVpAAV.CAG SFGFP: T203Y, F46L, T65G, S72A GltI: A184V Looger
pAAV.CAG.SF-Venus-iGluSnFR.S72ASF-Venus-iGluSnFR.S72A (Synthetic)AAVpAAV.CAG SFGFP: T203Y, F46L, T65G, S72A GltI: S72A Looger
pAAV.CAG-FLEX.SF-iGluSnFR.A184S.mRuby3SF-iGluSnFR.A184S (Synthetic)AAVpAAV.CAG-FLEX GltI: A184S + mRuby3 fusion Looger
pAAV.CAG-FLEX.SF-iGluSnFR.A184V.mRuby3SF-iGluSnFR.A184V (Synthetic)AAVpAAV.CAG-FLEX GltI: A184V + mRuby3 fusion Looger
pAAV.CAG-FLEX.SF-iGluSnFR.S72A.mRuby3SF-iGluSnFR.S72A (Synthetic)AAVpAAV.CAG-FLEX GltI: S72A + mRuby3 fusion Looger
AAV CMV-dSaCas9-KRAB-bGHpAdead S. aureus Cas9 KRAB (Other)Mammalian Expression, AAV, CRISPRpAAV D10A and H840A HA Gersbach
AAV-StufferAAVpTR Gersbach
AAV-U6-dgRNA-CAG-MPHMS2-P65-HSF1 (Homo sapiens)Mammalian Expression, AAV, CRISPRAAV Belmonte
AAV-nEF-dCas9nEF-dCas9Mammalian Expression, AAV, CRISPRAAVNLS, HA-NLS Belmonte
AAV-CMVc-Cas9Cas9 (Synthetic)Mammalian Expression, AAV, CRISPRAAVNLS, HA-NLS Belmonte
pX552-GFPGFP (Other)Mammalian Expression, AAV, CRISPRpAAV Hewitt
pX551-CMV-SpCas9SpCas9 (Other)Mammalian Expression, AAV, CRISPRpAAV Hewitt
pX551-miniCMV-SpCas9SpCas9 (Other)Mammalian Expression, AAV, CRISPRpAAV Hewitt
pX551-miniCMV-SaCas9SaCas9 (Other)Mammalian Expression, AAV, CRISPRpAAV Hewitt
pX551-miniCMV-CjCas9CjCas9 (Other)Mammalian Expression, AAV, CRISPRpAAV Hewitt
pX551-miniCMV-AsCpf1AsCpf1 (Other)Mammalian Expression, AAV, CRISPRpAAV Hewitt
pX551-CMV-CjCas9CjCas9 (Other)Mammalian Expression, AAV, CRISPRpAAV Hewitt
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA SaCas9 (Synthetic)Mammalian Expression, AAV, CRISPRpAAV Hewitt
pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA SaCas9 (Synthetic)Mammalian Expression, AAV, CRISPRpAAV Hewitt
pX601 miniCMV-SaCas9-SpA-sgRNA scaffoldMammalian Expression, AAV, CRISPRpAAV Hewitt
pAAV-CAG-EGFPKir7.1KCNJ13 (Homo sapiens)AAVpAV[Exp]-BsdEGFP Pattnaik
JGE301_pAAV-hSyn-DIO-Flag-hM3Dq-V2(2D)-ABIcs-mCherryhM3DREADD (Synthetic)AAVAAV2 T to D and S to D mutations in V2-tail ABIcs, FLAG, mCherry Roth
JGE302_pAAV-hSyn-DIO-Myc-PYLcs-bArrestin2-YFP (p2)ARRB2 (Synthetic)AAVAAV2YFP, MYC, PYLcs Roth
AAV-hSyn-mCherry-P2A-Cre-WPREhSyn-mCherry-P2A-Cre-WPRE (Other)Mammalian Expression, AAVpAAV Yang
AAV-aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyAaCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA (Other)Mammalian Expression, AAVpAAV Yang
pAAV-syn-AICD-IRES-hrGFPAICD (Homo sapiens)AAVpAAV-syn-GFP Marie
pAAV-syn-IRES-hrGFPAAVpAAV-syn-GFP Marie
AAV-tLucLuciferase (Other)AAVAAV Belmonte
AAV-tLuc-mCherryAAVAAV Belmonte
YA1529: pAAV_hSyn-QuasAr3-P2A-CheRiffQuasAr3-P2A-CheRiff (Synthetic)Mammalian Expression, AAVpAAV_hSyn Cohen
YA1531: pAAV_CAG-FLEX-QuasAr3QuasAr3 (Synthetic)Mammalian Expression, AAVpAAV-CAG-FLEX Cohen
YA1532: pAAV_ CAG-FLEX-paQuasAr3paQuasAr3 (Synthetic)Mammalian Expression, AAVpAAV-CAG-FLEX Cohen
YA1629: pAAV_CAG-FLEX-paQuasAr3-spaQuasAr3 (Synthetic)Mammalian Expression, AAVpAAV-CAG-FLEX Cohen
YA1627: pAAV_hSyn-Dio-paQuasAr3-s-P2A-CheRiff-spaQuasAr3-P2A-CheRiff (Synthetic)Mammalian Expression, AAVpAAV_hSyn Cohen
DRH323: pAAV_hSyn-QuasAr2QuasAr2 (Synthetic)Mammalian Expression, AAVpAAV_hSyn Cohen
pAAV CAGG eGFPeGFP (Other)Mammalian Expression, AAVpAAV-MCS Margrie
pAAV-hSynapsin- soCoChR-GFPsoCoChR-GFP (Other)Mammalian Expression, AAVpAAVKA2, EGFP Boyden
pAAV-EF1alpha-soCoChR-GFPsoCoChR-GFP (Other)Mammalian Expression, AAVpAAVKA2, EGFP Boyden
pAAV-CAG-soCoChR-GFPsoCoChR-GFP (Other)Mammalian Expression, AAVpAAVKA2, EGFP Boyden
pAAV-CaMKII-soCoChR-GFPsoCoChR-GFP (Other)Mammalian Expression, AAVpAAVKA2, EGFP Boyden
pAAV-hSynapsin-FLEX-soCoChR-GFPsoCoChR-GFP (Other)Mammalian Expression, AAVpAAVKA2, EGFP Boyden
pAAV-hSyn-soCoChR-mCardinalsoCoChR-mCardinal (Other)Mammalian Expression, AAVpAAVKA2, mCardinal Boyden
pAAV-EF1alpha-soCoChR-tdTomatosoCoChR-tdTomato (Other)Mammalian Expression, AAVpAAVKA2, tdTomato Boyden
AAV_CWSL.nEF.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3synaptophysin-GCaMP6s, mRuby3 (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxpAAV-CW3SL-EGFP Larsen
AAV_CWSL.hSyn.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3synaptophysin-GCaMP6s, mRuby3 (Rattus norvegicus)Mammalian Expression, AAV, Cre/LoxpAAV-CW3SL-EGFP Larsen
pAAV-hSyn-Cre-P2A-dTomatoCre, dTomatoMammalian Expression, AAV, Cre/LoxpAAV-hSyn1-DIO-SSFO-EYFP-P2A-nlsdTomato-WPRE-BGHpA Larsen
AAV pCAG-mRuby3-WPREmRuby3Mammalian Expression, AAVAAV pCAG-FLEX-tdTomato-WPRE (#51503) Larsen
AAV.TBG.PI.Cre.rBGCre (Other)Mammalian Expression, AAVpAAV Wilson
AAV.rTH.PI.Cre.SV40Cre (Other)Mammalian Expression, AAVpAAV Wilson
AAV.CamKII.GCaMP6s.WPRE.SV40GCaMP6sMammalian Expression, AAVpAAV Wilson
pAAV-hSyn-Htt171-66Q-myc-WPREExon 1 of mutant HTT, 66 polyQ repeats (Homo sapiens)AAVpAAV Jakobsson
pAAV-hSyn-Htt171-18Q-myc-WPREExon 1 of wild type HTT (Homo sapiens)AAVpAAV Jakobsson
pAAV2-SBECN1Wmouse Beclin-1 (BECN1) (Mus musculus)AAVpAAV Jakobsson
pAAV-EF1α1.1-FLEX-rc [ChrimsonR-GFP]ChrimsonR-GFP (Other)Mammalian Expression, AAVpAAV-EF1α1.1-FLEX Chrimson K176R mutant GFP Boyden
pAAV-EF1α1.1-FLEX-rc [Jaws-KGC-GFP-ER2]Jaws-KGC-GFP-ER2 (Other)Mammalian Expression, AAVpAAV-EF1α1.1-FLEX K200R W214F KGC, GFP, ER2 Boyden
pAAV-Syn-miRFPmiRFP (Synthetic)Mammalian Expression, AAVpAAV-Syn Boyden
pAAV-CaMKII-Archon1-EGFPArchon1-EGFP (Other)Mammalian Expression, AAVpAAV-CaMKII Boyden
pAAV-CaMKII-Archon1-KGC-EGFPArchon1-KGC-EGFP (Synthetic)Mammalian Expression, AAVpAAV-CaMKII Boyden
pAAV-CaMKII-Archon1-KGC-EGFP-ER2Archon1-KGC-EGFP-ER2 (Synthetic)Mammalian Expression, AAVpAAV-CaMKII Boyden
pAAV-CAG-Archon1-KGC-EGFP-ER2Archon1-KGC-EGFP-ER2 (Synthetic)Mammalian Expression, AAVpAAV-CAG Boyden
pAAV-CAG-Archon2-KGC-EGFP-ER2Archon2-KGC-EGFP-ER2 (Synthetic)Mammalian Expression, AAVpAAV-CAG Boyden
pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2Archon1-KGC-EGFP-ER2 (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV-FLEX Boyden
pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3ChroME-ST (Mus musculus)AAVpAAV Adesnik
pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-STeGtACR1-ST (Mus musculus)AAVpAAV Adesnik
1375_pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-CB-SACas9-HA-OLLAS-spALdlr gRNAMammalian Expression, AAV, CRISPRpEMBL8 Lagor
1162_pAAV-HLP-EmGFP-SpAEmGFPMammalian Expression, AAVpEMBL8 Lagor
1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spAMammalian Expression, AAV, CRISPRpEMBL8 Lagor
1476_pAAV-U6-SA-mMttp-gRNA-N21-HLP-SACas9-spAMttp gRNAMammalian Expression, AAV, CRISPRpEMBL8 Lagor
1518_pAAV-U6-SA-eGFP-gRNA-HLP-SACas9-HA-OLLAS-spAeGFP gRNAMammalian Expression, AAV, CRISPRpEMBL8 Lagor
1530_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-EmGFP-spAMammalian Expression, AAV, CRISPRpEMBL8 Lagor
1531_pAAV-U6-SA-Self1-gRNA-HLP-EmGFP-spASaCas9 RuvC gRNAMammalian Expression, AAV, CRISPRpEMBL8 Lagor
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spAMammalian Expression, AAV, CRISPRpEMBL8 Lagor
pU6-crRNA(SOD1)mCherry-KASH (Homo sapiens)AAVCustom Zhang
pU6-crRNA(TBK1)mCherry-KASH (Homo sapiens)AAVCustom Zhang
pU6-crRNA(TARDBP)mCherry-KASH (Homo sapiens)AAVCustom Zhang
pU6-crRNA(Non-targeting)mCherry-KASHAAVCustom Zhang
hSyn1-AsCpf1(RR)hAsCpf1(RR) (Homo sapiens)AAVCustom S542R/K607R NLS, HA Zhang
EFS-VectorMammalian Expression, Mouse Targeting, AAV, CRISPR, Synthetic BiologypAAV Chen
TBG-VectorMammalian Expression, Mouse Targeting, AAV, CRISPR, Synthetic BiologypAAV Chen
AAV-P(Cry1)-forward-intron336-Venus-NLS-D2Cry1 promoter and Venus (Mus musculus)Mammalian Expression, AAVaav2NLS-D2 Zhang
AAV-P(Cry1)-DIO-intron336-Venus-NLS-D2Cry1 promoter and Venus (Mus musculus)Mammalian Expression, AAV, Cre/Loxaav2NLS-D2 Zhang
AAV-P(Cry1)-DIO-intron336-dLUCCry1 promoter and luciferase (Mus musculus)Mammalian Expression, AAV, Cre/Loxaav2 Zhang
AAV-P(Per2)-DIO-intron2-Venus-NLS-D2Per2 promoter and Venus (Mus musculus)Mammalian Expression, AAV, Cre/Loxaav2NLS-D2 Zhang
AAV-P(Per2)-DIO-mCherry-Venus-NLS-D2Per2 promoter and mCherry and Venus (Mus musculus)Mammalian Expression, AAV, Cre/Loxaav2NLS-D2 Zhang
AAV-P(Per2)-DIO-intron2-dLUCPer2 promoter and luciferase (Mus musculus)Mammalian Expression, AAV, Cre/Loxaav2 Zhang
pAAV-CBA-DO(FAS)-GCaMP6sGCaMP6s (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAV Sabatini
pAAV-TRE-FLEX-ChR2-YFPtetO-Flex-ChR2-YFP (Synthetic)Mammalian Expression, AAVpAAV-MCS Chr2 H134R Kwon
pAAV-TRE-TdTomatotetO-TdTomato (Synthetic)Mammalian Expression, AAVpAAV-MCS Kwon
pAAV-TRE-ChR2-YFPtetO-ChR2-YFP (Synthetic)Mammalian Expression, AAVpAAV-MCS ChR2 H134R Kwon
pAAV-TRE-NpHR-YFPtetO-NpHR-YFP (Synthetic)Mammalian Expression, AAVpAAV-MCS Kwon
pAAV-IV-3xFLAG/HA/NBL103xFLAG/HA-tagged anti-GFP VHH (Other)Mammalian Expression, AAV, Cre/Lox, Synthetic BiologypAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Nectow
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNASt1Cas9 LMD-9 (Homo sapiens), sgRNA for St1Cas9 (Homo sapiens)Mammalian Expression, Mouse Targeting, AAV, CRISPRpX602 (Plasmid #61593)SV40 NLS Doyon
pAAV-hSyn-dLight1.1dLight1.1 (Synthetic)AAVpAAV-hSynFlag tag Tian
pAAV-CAG-dLight1.1dLight1.1 (Synthetic)AAVpAAV-CAGFlag tag Tian
pAAV-hSyn-dLight1.2dLight1.2 (Synthetic)AAVpAAV-hSynFlag tag Tian
pAAV-CAG-dLight1.2dLight1.2 (Synthetic)AAVpAAV-CAGFlag tag Tian
pAAV-hSynapsin1-axon-GCaMP6maxon-GCaMP6m (Synthetic)Mammalian Expression, AAVpAAVGAP43 palmitoylation domain Tian
pAAV-hSynapsin1-axon-GCaMP6saxon-GCaMP6s (Synthetic)Mammalian Expression, AAVpAAVGAP43 palmitoylation domain Tian
pAAV-hSyn-DIO {ChETA}on-WPREChETA (Synthetic)Mammalian Expression, AAVpAAV humanized ChR2, E123T/H134R HA Kepecs
pAAV-hSyn-DIO {mCAR}off-{ChETA}on-WPREmCAR (Mus musculus), ChETA (Synthetic)Mammalian Expression, AAVpAAVMyc, HA Kepecs
pAAV-hSyn-DIO {hCAR}off-{ChETA}on-WPREhCAR (Homo sapiens), ChETA (Synthetic)Mammalian Expression, AAVpAAVMyc, HA Kepecs
pAAV-hSyn-DIO {ChETA-mRuby2}on-W3SLChETA-mRuby2 (Synthetic), W3SL (Synthetic)Mammalian Expression, AAVpAAV W3SL is built from a shortened WPRE, an upstream element and SV40 late polyadenylation signal (Choi et al., 2014). This W3SL cassette allows 0.7 kb additional cloning capacity and shows comparable expression efficiency with conventional WPRE-polyA cassettes. mRuby2 Kepecs
pAAV-hSyn-DIO {mCAR}off-{ChETA-mRuby2}on-W3SLmCAR (Mus musculus), ChETA-mRuby2 (Synthetic)Mammalian Expression, AAVpAAVMyc, mRuby2 Kepecs
pAAV-hSyn-DIO {hCAR}off-{ChETA-mRuby2}on-W3SLhCAR (Homo sapiens), ChETA-mRuby2 (Synthetic)Mammalian Expression, AAVpAAVMyc, mRuby2 Kepecs
pAAV-hSyn-DIO {hCAR}off-{ChETA-EYFP}on-W3SLhCAR (Homo sapiens), ChETA-EYFP (Synthetic)Mammalian Expression, AAVpAAVEYFP, Myc Kepecs
pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPREmCAR (Mus musculus), GCaMP6f (Synthetic)Mammalian Expression, AAVpAAVT7, Myc, Xpress, 6xHis Kepecs
pAAV-hSyn-DIO {hCAR}off-{GCaMP6f}on-W3SLhCAR (Homo sapiens), GCaMP6f (Synthetic)Mammalian Expression, AAVpAAVT7, Myc, Xpress, 6xHis Kepecs
pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPREmCAR (Mus musculus), DTR-EGFPMammalian Expression, AAVpAAVMyc, EGFP Kepecs
pAAV-hSyn-DIO {hCAR}off-{DTR-GFP}on-W3SLhCAR (Homo sapiens), DTR-EGFPMammalian Expression, AAVpAAVMyc, EGFP Kepecs
pAAV-hSyn-DIO {hCAR}off-{hM4Di-mCherry}on-W3SLhCAR (Homo sapiens), hM4Di-mCherryMammalian Expression, AAVpAAVMyc, mCherry Kepecs
pZac2.1-GfaABC1D-mCherry-hPMCA2w/bPlasma membrane calcium pump 2, variant w/b (Homo sapiens)AAVpZac2.1mCherry Khakh
pAAV-CWB-cyan pre-eGRASP(p32)cyan pre-eGRASP(p32)AAVpAAV Kaang
pAAV-CWB-yellow pre-eGRASP(p32)yellow pre-eGRASP(p32)AAVpAAV Kaang
pAAV-EWB-DIO-myrTagRFP-T-P2A-post-eGRASPmyrTagRFP-T-P2A-post-eGRASPAAVpAAV Kaang
pAAV-TIWB-yellow pre-eGRASP(p32)yellow pre-eGRASP(p32)AAVpAAV Kaang
pAAV-EWB-DIO-cyan pre-eGRASP(p30)cyan pre-eGRASP(p30)AAVpAAV Kaang
pAAV-TIWB-myrmScarlet-I-P2A-post-eGRASPmyrmScarlet-I-P2A-post-eGRASPAAVpAAV Kaang
pAAV-EWB-DIO-myriRFP670V5-P2A-post-eGRASPmyriRFP670V5-P2A-post-eGRASPAAVpAAV Kaang
pAAV-CWB-cyan pre-eGRASP(p30)cyan pre-eGRASP(p30)AAVpAAV Kaang
pAAV-CWB-yellow pre-eGRASP(p30)yellow pre-eGRASP(p30)AAVpAAV Kaang
pAAV-TIWB-yellow pre-eGRASP(p30)yellow pre-eGRASP(p30)AAVpAAV Kaang
pAAV-EWB-DIO-cyan pre-eGRASP(p32)cyan pre-eGRASP(p32)AAVpAAV Kaang
pAAV-TIWB-myrTagRFP-T-P2A-post-eGRASPmyrTagRFP-T-P2A-post-eGRASPAAVpAAV Kaang
pAAV-CWB-pre-eGRASP(p30)green pre-eGRASP(p30)AAVpAAV Kaang
pAAV-CWB-pre-eGRASP(p32)green pre-eGRASP(p32)AAVpAAV Kaang
pEMS2131AAVpEMS2131 Simpson
pEMS2241Ple320 (Homo sapiens)AAVpEMS2131 Simpson
pEMS2242Ple321 (Homo sapiens)AAVpEMS2131 Simpson
pEMS2272Ple342 (Homo sapiens)AAVpEMS2131 Simpson
pEMS2273Ple343 (Homo sapiens)AAVpEMS2131 Simpson
pEMS2274Ple344 (Homo sapiens)AAVpEMS2131 Simpson
pEMS2280Ple345 (Homo sapiens)AAVpEMS2131 Simpson
pEMS2281Ple346 (Homo sapiens)AAVpEMS2131 Simpson
pAAV-hSynapsin1-axon-GCaMP6faxon-GCaMP6f (Synthetic)Mammalian Expression, AAVpAAVGAP43 palmitoylation domain Tian
pAAV-hSynapsin1-axon-GCaMP6s-P2A-mKate2axon-GCaMP6s-P2A-mKate2 (Synthetic)Mammalian Expression, AAVpAAVGAP43 palmitoylation domain Tian
pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3axon-GCaMP6s-P2A-mRuby3 (Synthetic)Mammalian Expression, AAVpAAVGAP43 palmitoylation domain Tian
pAAV-hSynapsin1-GCaMP6s-P2A-mKate2GCaMP6s-P2A-mKate2 (Synthetic)Mammalian Expression, AAVpAAV Tian
pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3GCaMP6s-P2A-mRuby3 (Synthetic)Mammalian Expression, AAVpAAV Tian
pAAV-hSynapsin1-FLEx-axon-GCaMP6s-P2A-mRuby3axon-GCaMP6s-P2A-mRuby3 (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAVGAP43 palmitoylation domain Tian
pAAV-hSynapsin1-FLEx-axon-GCaMP6saxon-GCaMP6s (Synthetic)Mammalian Expression, AAV, Cre/LoxpAAVGAP43 palmitoylation domain Tian
pEJS654 All-in-One AAV-sgRNA-hNmeCas9sgRNA scaffold, Human-codon-optimized NmeCas9 (Other)Mammalian Expression, Mouse Targeting, AAV, CRISPRPX551-Plasmid #60957 Sontheimer
pAAV.hSynap.iGABASnFRiGABASnFR (Other)AAVpAAV.hSynapsin Looger
pAAV.hSynap.iGABASnFR.F102GiGABASnFR.F102G (Other)AAVpAAV.hSynapsin F102G Looger
pAAV.hSynap.iGABASnFR.F102Y.Y137LiGABASnFR.F102Y.Y137L (Other)AAVpAAV.hSynapsin F102Y.Y137L Looger
pAAV.hSynap.iGABASnFR.R205AiGABASnFR.R205A (Other)AAVpAAV.hSynapsin R205A (no GABA binding) Looger
pAAV.hSyn-FLEX.iGABASnFR.F102Y.Y137LiGABASnFR.F102Y.Y137L (Other)AAVpAAV.SynFLEX F102Y.Y137L Looger
pAAV.Syn-FLEX.iGABASnFR.mRuby3iGABASnFR (Other)AAVpAAV.SynFLEXmRuby3 Looger
pAAV.Syn-FLEX.iGABASnFR.F102G.mRuby3iGABASnFR.F102G (Other)AAVpAAV.SynFLEX F102G mRuby3 Looger
pAAV.Syn-FLEX.iGABASnFR.F102Y.Y137L.mRuby3iGABASnFR.F102Y.Y137L (Other)AAVpAAV.SynFLEX F102Y.Y137L mRuby3 Looger
pAAV.GFAP.iGABASnFR.F102Y.Y137LiGABASnFR.F102Y.Y137L (Other)AAVpAAV.GFAP F102Y.Y137L Looger
SLF155: AAV-syn-DO-H2B-jRGECO1aH2B-jRGECO1a (Synthetic)Mammalian Expression, AAV, Cre/LoxAAV-synP-F Cohen
SLF045: AAV-hSyn-eTsChR-GFPeTsChR (Synthetic)Mammalian Expression, AAVpAAV-hSynGFP Cohen
pZac2.1 GfaABC1D ChR2(H134R) mCherry SV40ChR2(H134R) (Synthetic)AAVpZac2.1 H134R mCherry Khakh
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFPNuclear-localized floxed-mCherry EGFPAAVpOTTC407Nuclear localization signal Harvey
pOTTC1442 - pAAV CMV-IE Nuc-iRFP-2A-iCreiRFP713 (Other)AAVpOTTC10312A-iCre, Nuclear localization signal Harvey
pOTTC1440 - pAAV CMV-IE Nuc-iRFP-2A-FlpoiRFP713 (Other)AAVpOTTC1031Nuclear localization signal, 2A-Flpo Harvey
pOTTC1124 - pAAV MeCP2 SpCas9(D10A)SpCas9 (Synthetic)AAVpX551 D10A Harvey
pAAV hSyn GFP-Fxr1Fxr1p (Mus musculus)Mammalian Expression, AAVpAAVGFP Beaulieu
pAAV Gsk3 sgRNA/GFPGFP (Mus musculus)Mammalian Expression, AAV, CRISPRPX552 Beaulieu
pAAV-CMV-SpyCas9SpyCas9Mammalian Expression, AAV, CRISPR, Synthetic BiologyssAAV vector Niopek
pAAV-CMV-CASANOVACASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)Mammalian Expression, AAV, CRISPR, Synthetic BiologyscAAV vector Niopek
pAAV-CMV-NLS-AcrIIA4SV40 NLS-AcrIIA4Mammalian Expression, AAV, CRISPR, Synthetic BiologyscAAV vector Niopek
pAAV-RSV-GFP-U6-gRNA scaffold (SpyCas9)2x BbsI sites - SpCas9 scaffold, co-expressed GFP (transfection marker)Mammalian Expression, AAVscAAV vector Niopek
pAAV-RSV-GFP-U6-EMX1 gRNA (SpyCas9 scaffold)gRNA EMX1 (SpCas9 scaffold), co-expressed GFP (transfection marker)Mammalian Expression, AAV, CRISPR, Synthetic BiologyscAAV vector Niopek
pAAV-RSV-GFP-U6-CCR5 gRNA (SpyCas9 scaffold)gRNA CCR5 (SpCas9 scaffold), co-expressed GFP (transfection marker)Mammalian Expression, AAV, CRISPR, Synthetic BiologyscAAV vector Niopek
pAAV-RSV-GFP-U6-CFTR gRNA (SpyCas9 scaffold) CFTR gRNA (SpCas9 scaffold), co-expressed GFP (transfection marker)Mammalian Expression, AAV, CRISPR, Synthetic BiologyscAAV vector Niopek
pAAV-hSyn-GRAB_DA1mGPCR activation based DA sensor GRAB_DA1m (Homo sapiens)AAVpAAV Li
pAAV-hSyn-GRAB_DA1hGPCR activation based DA sensor GRAB_DA1h (Homo sapiens)AAVpAAV Li
IL1RN gRNA1IL1RN guideRNA 1 (SpCas9 scaffold), co-expressed GFP (transfection marker)Mammalian Expression, AAV, CRISPR, Synthetic BiologyscAAV vector Niopek
IL1RN gRNA2IL1RN guideRNA 1 (SpCas9 scaffold), co-expressed GFP (transfection marker)Mammalian Expression, AAV, CRISPR, Synthetic BiologyscAAV vector Niopek
IL1RN gRNA3IL1RN guideRNA 3 (SpCas9 scaffold), co-expressed GFP (transfection marker)Mammalian Expression, AAV, CRISPR, Synthetic BiologyscAAV vector Niopek
IL1RN gRNA4IL1RN guideRNA 4 (SpCas9 scaffold), co-expressed GFP (transfection marker)Mammalian Expression, AAV, TALEN, Synthetic BiologyscAAV vector Niopek
pOTTC1088 - pAAV TH gRNA A+B pair EF1a EGFPTwo gRNAs for rat TH (Rattus norvegicus)Mammalian Expression, AAV, CRISPRpOTTC407 Harvey
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFPTwo gRNAs for rat Rosa26 (Rattus norvegicus)Mammalian Expression, AAV, CRISPRpOTTC407 Harvey
pOTTC1388 - pAAV MANF gRNA A+B EF1a EGFPTwo gRNAs for rat MANF (Rattus norvegicus)Mammalian Expression, AAV, CRISPRpOTTC407 Harvey
pOTTC1179 - pAAV (flox-stop) TH gRNA A EF1a eGFPgRNA for rat TH (Rattus norvegicus)Mammalian Expression, AAV, Cre/Lox, CRISPRpOTTC407 Harvey
pOTTC1079 - pAAV TH gRNA A EF1a EGFPgRNA for rat TH (Rattus norvegicus)Mammalian Expression, AAV, CRISPRpOTTC407 Harvey
pJEP302-pAAV-CMV-dSaCas9-KRAB-pAde-catalyzed SaCas9 (Synthetic)AAV, CRISPRAAVNLS, KRAB Ploski
pJEP303-pAAV-CMV-dSaCas9-VP64-pAde-catalyzed SaCas9 (Synthetic)AAV, CRISPR, Synthetic BiologyAAVVP64, NLS Ploski
pJEP304-pAAV-EFS-dSaCas9-VP64-pAde-catalyzed SaCas9 (Synthetic)AAV, CRISPR, Synthetic BiologyAAVVP64, NLS Ploski
pJEP305-pAAV-EFS-dSaCas9-KRAB-pAde-catalyzed SaCas9 (Synthetic)AAV, CRISPRAAVNLS, KRAB Ploski
pAAV-hSyn-NES-NIR-GECO1NES-NIR-GECO1 (Synthetic)AAVpAAV Campbell
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pAinverted de-catalyzed SaCas9 (Synthetic)AAV, Cre/Lox, CRISPR, Synthetic BiologyAAVVP64, NLS Ploski
pJEP309-pAAV-EFS-dSaCas9-KRAB-Dio-pAde-catalyzed SaCas9 (Synthetic)AAV, Cre/Lox, CRISPRAAVKRAB Ploski
pJEP314-pAAV-U6SaCas9gRNA(SapI)-CMV-SaCas9-DIO-pASaCas9AAV, Cre/Lox, CRISPRAAVNLS Ploski
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pASaCas9, SaCas9 gRNA CassetteMouse Targeting, AAV, Cre/Lox, CRISPRAAVNLS Ploski
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty CassetteSaCas9 gRNA Cassete (Synthetic)AAV, CRISPRAAV Ploski
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pASaCas9 gRNA Cassete (Synthetic), GFP (Synthetic)AAV, CRISPRAAVKASH Ploski
pJEP318-pAAV-U6SaCas9gRNA(emx1sg1)-EFS-GFP-KASH-pASaCas9 gRNA Cassete (Synthetic), GFP (Synthetic)AAV, CRISPRAAVKASH Ploski
pJEP319-pAAV-U6SaCas9gRNA(emx1sg2)-EFS-GFP-KASH-pASaCas9 gRNA Cassete (Synthetic), GFP (Synthetic)AAV, CRISPRAAVKASH Ploski
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pASaCas9 gRNA Cassete (Synthetic), GFP (Synthetic)AAV, CRISPRAAVKASH Ploski
pJEP321-pAAV-FullU6TO-SaCas9gRNAi(SapI)-CMV-TetR-P2A-GFP-KASH-WPRE-shortPA Empty CassetteSaCas9 gRNA Cassete (Synthetic), GFP (Synthetic)AAV, CRISPRAAVKASH Ploski
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPASaCas9 gRNA Cassete (Synthetic), GFP (Synthetic)AAV, CRISPRAAVKASH Ploski
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty CassetteSaCas9 gRNA Cassete (Synthetic), GFP (Synthetic)AAV, CRISPRAAVKASH Ploski
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPASaCas9 gRNA Cassete (Synthetic), GFP (Synthetic)AAV, CRISPRAAVKASH Ploski
pJEP325-pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPASaCas9 gRNA Cassete (Synthetic), GFP (Synthetic)Mouse Targeting, AAV, CRISPRAAVKASH Ploski
aav-SYN-tdNfsB(F124W)-mCherry (eNTR)tdNfsB(F124W)-mCherry (Other)Mammalian Expression, AAVAAV2 F124W mCherry Lavis
aav-CAG-tdNfsB(F124W)-mCherry (eNTR)tdNfsB(F124W)-mCherry (Other)Mammalian Expression, AAVAAV2 F124W mCherry Lavis
aav-CAG-FLEX-tdNfsB(F124W)-mCherry (eNTR)tdNfsB(F124W)-mCherry (Other)Mammalian Expression, AAV, Cre/LoxAAV2 F124W mCherry Lavis
aav-SYN-FLEX-tdNfsB(F124W)-mCherry (eNTR)tdNfsB(F124W)-mCherry (Other)Mammalian Expression, AAV, Cre/LoxAAV2 F124W mCherry Lavis
pAAV-hSyn-LMO3 (sbGLuc-VChR1-EYFP)Gaussia luciferase, slow burn, Volvox Channelrhodopsin 1, Enhanced Yellow Fluorescent ProteinMammalian Expression, AAVpAAV Hochgeschwender
pAAV-hSyn-iLMO (slGLuc-Mac-EYFP)Gaussia luciferase, superluminescent, Leptosphaeria maculans, Enhanced Yellow Fluorescent ProteinMammalian Expression, AAVpAAV Hochgeschwender
pAAV-hSyn-LMO4 (GLucM23-VChR1-EYFP)Gaussia luciferase, M23, Volvox Channelrhodopsin 1, Enhanced Yellow Fluorescent ProteinMammalian Expression, AAVpAAV Hochgeschwender
pAAV-hSyn-iLMO4 (GLucM23-iChloC-EYFP)Gaussia luciferase, M23, improved slowChloC artificial anion conducting ChR, Enhanced Yellow Fluorescent ProteinMammalian Expression, AAVpAAV Hochgeschwender
pAAV-Hb9-LMO3 (sbGLuc-VChR1-EYFP)Gaussia luciferase, slow burn, Volvox Channelrhodopsin 1, Enhanced Yellow Fluorescent ProteinMammalian Expression, AAVpAAV Hochgeschwender
pAAV-CAG-LMO3 (sbGLuc-VChR1-EYFP)Gaussia luciferase, slow burn, Volvox Channelrhodopsin 1, Enhanced Yellow Fluorescent ProteinMammalian Expression, AAVpAAV Hochgeschwender
pAAV-EFIa-DIO-LMO3 (sbGLuc-VChR1-EYFP)Gaussia luciferase, slow burn, Volvox Channelrhodopsin 1, Enhanced Yellow Fluorescent ProteinMammalian Expression, AAVpAAV Hochgeschwender
pAAV-hSyn-sbGLuc-ChR2(CS/DA)-EYFPGaussia luciferase, slow burn, Channelrhodopsin 2(CS/DA), stable step function opsin, Enhanced Yellow Fluorescent ProteinMammalian Expression, AAVpAAV Hochgeschwender
pAAV-hSyn-sbGLuc-CheRiff-EGFPGaussia luciferase, slow burn, CheRiff, synthetic ChR, Enhanced Green Fluorescent ProteinMammalian Expression, AAVpAAV Hochgeschwender
AAV-hSyn-EGFPEnhanced Green Fluorescent Protein (Mus musculus)Mammalian Expression, Mouse Targeting, AAVAAVNone Han
AAV-hSyn-EGFP-8X2C (AAV GABA mAGNET)Enhanced Green Fluorescent Protein (Mus musculus)Mammalian Expression, Mouse Targeting, AAVAAVNone Han
AAV-CamKIIa-ChR2-EGFPChannelrhodopsin 2 (Mus musculus)Mammalian Expression, Mouse Targeting, AAVAAVEGFP Han
AAV-hSyn-Jaws-mRuby2-8X2CJaws (rhodopsin) (Mus musculus)Mammalian Expression, Mouse Targeting, AAVAAVmRuby2 Han
pAAV-EF1α-DIO-ReaChR-P2A-dTomatoReaChR-P2A-dTomatoMammalian Expression, AAVpAAVdTomato Xue
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Nlgn1CGtACR2-EYFP-Nlgn1CMammalian Expression, AAVpAAVEYFP, Nlgn1C Xue
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv4.2LLGtACR2-EYFP-Kv4.2LLMammalian Expression, AAVpAAVEYFP, Kv4.2LL Xue
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-TlcnCGtACR2-EYFP-TlcnCMammalian Expression, AAVpAAVEYFP, TlcnC Xue
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1CGtACR2-EYFP-Kv2.1CMammalian Expression, AAVpAAVEYFP, Kv2.1C Xue
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-TlcnCGtACR2-EYFP-Kv2.1C-TlcnCMammalian Expression, AAVpAAVEYFP, TlcnC, Kv2.1C Xue
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-linker-TlcnCGtACR2-EYFP-Kv2.1C-linker-TlcnCMammalian Expression, AAVpAAVEYFP, Kv2.1C-linker-TlcnC Xue
pAAV-CaMKIIa-mCherrymCherry (Other)AAVAAV Deisseroth
pAAV-Ef1a-mCherrymCherry (Other)AAVAAV Deisseroth
pAAV-Ef1a-fDIO mCherrymCherry (Other)AAVAAV Deisseroth
pAAV-hSyn-mCherrymCherry (Other)AAVAAV Deisseroth
pAAV-PTRE-tight-flex-hM3Dq-mCherry-WPRE-pAPTRE - tet activator responsive promoter (Synthetic), flex sequence (Synthetic), hM3dq-mCherry (inverted) (Other), flex sequenceMammalian Expression, AAVpUChM3Dq-mCherry Wisden
pAAV-UbC-mEmerald Rab7aRab7a fused to mEmerald (Homo sapiens)Mammalian Expression, AAVpAAV-SIBR-anti_I 7 Amino Acids (21 Nucleotides) between mEmerald and Rab7a mEmerald Tsoulfas
pAAV-UbC-mCherry Rab5Rab5a (Homo sapiens)Mammalian Expression, AAVpAAV-SIBR-anti_ImCherry Tsoulfas
pAAV2-TBG-FLAG-mRIPK1RIPK1 (Mus musculus)Mammalian Expression, AAVpAAV2Flag Yuan
pAAV2-TBG-FLAG-mRIPK1-S321ARIPK1 (Mus musculus)Mammalian Expression, AAVpAAV2 S321A Flag Yuan
pAAV2-TBG-FLAG-mRIPK1-S321ERIPK1 (Mus musculus)Mammalian Expression, AAVpAAV2 S321E Flag Yuan
pAAV-Syn-VARNAMVARNAM (Synthetic)AAVpAAV-SynapsinGolgi and ER export signal Pieribone
pAav-TP53-T2A-BirA*TP53 (Homo sapiens), TP53 (Homo sapiens), T2A (Synthetic), BirA* (Other)AAVpAav Homology region 1, Homology region 2 T2A, BirA* Eyckerman
pCMV-sadCas9-VP64dCas9-VP64 (Other)Mammalian Expression, AAVpAAV-NLS-dSaCas9-NLS-VPRVP64 Ahituv
pCMV-SpdCas9-VP64VP64 (Other)Mammalian Expression, AAVpAAV-Ef1a-FAS-EGFP-WPRE-pA3XFLAG, dCas9-VP64 Ahituv
pAAV-EF1α1.1-Archon1-KGC-GFP-ER2Archon1-KGC-GFP-ER2 (Synthetic)Mammalian Expression, AAVpAAV-EF1a 1.1KGC, GFP, ER2 Boyden
pAAV-EF1α1.1-FLEX-rc [Archon1-KGC-GFP-ER2]Archon1-KGC-GFP-ER2 (Synthetic)Mammalian Expression, AAVpAAV-EF1a 1.1-FLEXKGC, GFP, ER2 Boyden
pAAV-Syn-Archon1-KGC-GFP-ER2Archon1-KGC-EGFP-ER2 (Synthetic)Mammalian Expression, AAVpAAV-SynKGC, GFP, ER2 Boyden
pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2]Archon1-KGC-EGFP-ER2 (Synthetic)Mammalian Expression, AAVpAAV-Syn-FLEXKGC, GFP, ER2 Boyden
pAAV-CAG-H2B tdTomatoH2B tdTomato (Other)AAVpAAV Looger
pAAV- CAG-h2BmRuby2FLAGH2BmRuby2FLAG (Other)AAVpAAV Looger
pAAV-dAPEX2dAPEX2 (Other)Mammalian Expression, AAVpAAV W41F and A134P on soybean APX Ginty
pAAV-DIO-dAPEX2dAPEX2 (Other)Mammalian Expression, AAV, Cre/LoxpAAV W41F and A134P on soybean APX Ginty
pAAV-FDIO-dAPEX2dAPEX2 (Other)Mammalian Expression, AAV ; Flp/FRTpAAV W41F and A134P on soybean APX Ginty
pAAV-COX4-dAPEX2COX4-dAPEX2 (Other)Mammalian Expression, AAVpAAV W41F and A134P on soybean APX Ginty
pAAV-DIO-COX4-dAPEX2COX4-dAPEX2 (Other)Mammalian Expression, AAV, Cre/LoxpAAV W41F and A134P on soybean APX Ginty
pAAV-FDIO-COX4-dAPEX2COX4-dAPEX2 (Other)Mammalian Expression, AAV ; Flp/FRTpAAV W41F and A134P on soybean APX Ginty
pAAV-LACTB-dAPEX2LACTB-dAPEX2 (Other)Mammalian Expression, AAVpAAV W41F and A134P on soybean APX Ginty
pAAV-DIO-LACTB-dAPEX2LACTB-dAPEX2 (Other)Mammalian Expression, AAV, Cre/LoxpAAV W41F and A134P on soybean APX Ginty
pAAV-FDIO-LACTB-dAPEX2LACTB-dAPEX2 (Other)Mammalian Expression, AAV ; Flp/FRTpAAV W41F and A134P on soybean APX Ginty
pAAV-IGK-dAPEX2-KDELIGK-dAPEX2-KDEL (Other)Mammalian Expression, AAVpAAV W41F and A134P on soybean APX Ginty
pAAV-DIO-IGK-dAPEX2-KDELIGK-dAPEX2-KDEL (Other)Mammalian Expression, AAV, Cre/LoxpAAV W41F and A134P on soybean APX Ginty
pAAV-FDIO-IGK-dAPEX2-KDELIGK-dAPEX2-KDEL (Other)Mammalian Expression, AAV ; Flp/FRTpAAV W41F and A134P on soybean APX Ginty
pAAV-SYP-HRPSYP-HRP (Other)Mammalian Expression, AAVpAAV Ginty
pAAV-DIO-SYP-HRPSYP-HRP (Other)Mammalian Expression, AAV, Cre/LoxpAAV Ginty
pAAV-FDIO-SYP-HRPSYP-HRP (Other)Mammalian Expression, AAV ; Flp/FRTpAAV Ginty
CAG-eYFP-3x-miR204-5p-TSEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA (Synthetic)Mammalian Expression, AAVpAAV Gradinaru
CAG-eYFP-3x-miR708-5p-TSEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT (Synthetic)Mammalian Expression, AAVpAAV Gradinaru
hSyn1-eYFPEYFP (Synthetic)Mammalian Expression, AAVpAAV Gradinaru
TRE-DIO-eYFPEYFP (Synthetic)Mammalian Expression, AAVpAAV Gradinaru
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TSGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA (Synthetic)Mammalian Expression, AAVpAAV Gradinaru
pZac2.1-GfaABC1D-GAT3-HA-mCherrySlc6a11 (Mus musculus)Mammalian Expression, AAVpZac2.1HA, mCherry Khakh
hSyn1-2xNLS-mTurquoise22xNLS-mTurquoise2 (Synthetic)AAVpAAVNLS Gradinaru
pAAV-TRE-fDIO-GFP-IRES-tTATRE-fDIO-GFP-IRES-tTA (Synthetic)AAVpAAV2 See depositor comments below Luo
pAAV-TRE-dDIO-vCreTRE-dDIO-vCre (Synthetic)AAVpAAV2 See depositor comments below Luo
pAAV-TRE-vDIO-mScarlet-IRES-tTATRE-vDIO-mScarlet-IRES-tTA (Synthetic)AAVpAAV2 Luo
pAAV-DYRK1A-2A-GFPdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Mus musculus)Mammalian Expression, AAVpAAV-2A-GFPGFP, 2A peptide Lemmon
pAAV-DYRK1A-2A-mCherrydual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Mus musculus)Mammalian Expression, AAVpAAV-2A-mCherrymCherry, 2A peptide Lemmon
pAAV-EF1a-FLEX(frt)-GCaMP6f-WPREGCaMP6f (Rattus norvegicus)Mammalian Expression, AAVpAAV-Ef1a-fDIO EYFPT7 epitope, Xpress tag, 6xHis (N terminal on insert) Uchida
pAAV-camk2-Sthk-p2a-bpac(WT) minWPREbPAC(WT) (Other), SthK (Other)Mammalian Expression, AAVCW3SLmyc tag, P2A, mCherry, His tag Schmitz
pAAV-CamKII-GFP-P2A-bReaches-minWPREEGFP (Other), bReaCHES (Synthetic)AAVCW3SLP2A Schmitz
pAAV-CamkII-bPac(WT)-mCherry-minWPRE.sbdbPAC(WT) (Other)AAVCW3SLmyc, mCherry Schmitz
pAAV-EF1a-SwitchON_mRubyNLS-hChR2(H134R)-EYFP-NO_WPREmRuby2 (Synthetic), ChR2(H134R) (Synthetic)AAV, Cre/LoxpAAVSV40 NLS, YFP Schmitz
pAAV-DYRK2-2A-GFPdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 (Mus musculus)Mammalian Expression, AAVpAAV-2A-GFPGFP, 2A peptide Lemmon
pAAV-DYRK2-2A-mCherrydual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 (Mus musculus)Mammalian Expression, AAVpAAV-2A-mCherrymCherry, 2A peptide Lemmon
pAAV-DYRK3-2A-GFPdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (Mus musculus)Mammalian Expression, AAVpAAV-2A-GFPGFP, 2A peptide Lemmon
pAAV-DYRK3-2A-mCherrydual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (Mus musculus)Mammalian Expression, AAVpAAV-2A-mCherrymCherry, 2A peptide Lemmon
pAAV-DYRK4-2A-GFPdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (Mus musculus)Mammalian Expression, AAVpAAV-2A-EGFPEGFP, 2A peptide Lemmon
pAAV-DYRK4-2A-mCherrydual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (Mus musculus)Mammalian Expression, AAVpAAV-2A-EGFPmCherry, 2A peptide Lemmon
pAAV-DCX-2A-mCherrydoublecortin (Homo sapiens)Mammalian Expression, AAVpAAV-2A-mCherrymCherry, 2A peptide Lemmon
pAAV-DCX(S306A)-2A-mCherryDoublecortin (Homo sapiens)Mammalian Expression, AAVpAAV-2A-mCherry changed Serine 306 to Alanine mCherry, 2A peptide Lemmon
pAAV-DCX(S306D)-2A-mCherryDoublecortin (Homo sapiens)Mammalian Expression, AAVpAAV-2A-mCherry Serine 306 changed to Aspartic Acid mCherry, 2A peptide Lemmon
ssAAV-EF1a-FLuc-WPRE-HgHpA_bac_293Firefly luciferase (Other)Mammalian Expression, Insect Expression, AAV, Luciferase, Synthetic BiologypFB-AAV-mcs-shuttle_UIowa G0202 Paulk
AAV-syn-GCaMP6m-XCGCaMP6m-XC (Synthetic)AAVpHBAAV-hsyn-MCS-T2A-ZsGreen Liu
pAAV-hsyn-flex-VoltronVoltron (Synthetic)Mammalian ExpressionpAAV-hsyn Schreiter
pAAV-hsyn-flex-Voltron-STVoltron-ST (Synthetic)Mammalian Expression, AAVpAAV-hsyn Schreiter
pAAV-HyPer-DAAO-NESHyPer-DAAO-NES (Other)Mammalian Expression, AAVpAAV-MCSNES Michel
pAAV-HyPer3HyPer3 (Other)Mammalian Expression, AAVpAAV-MCSNone Michel
pAAV-SypHer2-DAAO-NESSypHer2-DAAO-NES (Other)Mammalian Expression, AAVpAAV-MCSNES Michel
psubCMV-mVEGF-D-WPREVegfd (Mus musculus)AAVpsubCMV-WPRE Alitalo
psubCAG-WPRE-hVEGF-D-StreptVEGFD (Homo sapiens)AAVpsubCAG-WPREStrept Alitalo
psubCMV-mVEGF-D-dNdC-WPREVegfd-dN-dC (Mus musculus)AAVpsubCMV-WPRE Alitalo
psubCMV-WPRE-IL3SP-mVEGF-D-dNdCIL3SP-Vegfd-dNdC (Mus musculus)AAVpsubCMV-WPRE Alitalo
pAAV_hsyn_NES-his-CaMPARI2-F391W-L398VCaMPARI2 (Synthetic), CaMPARI2 (Synthetic)Mammalian Expression, AAVpAAV F391W, L398V NES-his Oertner
SynTagMA_postSynTagMA (Synthetic)Mammalian Expression, AAVpAAVFLAG Oertner
SynTagMA_preSynTagMA_pre (Synthetic)Mammalian Expression, AAVpAAV Oertner
AAV SYN flex PSAM4 GlyR IRES EGFPPSAM4 GlyR IRES eGFP (Homo sapiens)Mammalian Expression, AAVpAAV L131G, Q139L, Y217F Sternson
pAAV-DIO-TVA-V5-RGTVA, V5, Rabies Glycoprotein (Synthetic)AAV, Cre/LoxpAAVV5 Carlén
AAV CAMKII PSAM4 GlyR IRES EGFPPSAM4 GlyR IRES eGFP (Homo sapiens)Mammalian Expression, AAVpAAV L131G, Q139L, Y217F Sternson
pAAV-HDR-mEGFP-Actinbeta Actin (Mus musculus)Mouse Targeting, AAV, CRISPRPX551 Yasuda
Nme2Cas9_AAVNme2Cas9 (Other)Mammalian Expression, AAVAAV Sontheimer
pLV302N-terminal SaKKH-BE3(739) - N-Intein (Npu DnaE) (Rattus norvegicus)Mammalian Expression, AAV, CRISPRpx601 Schwank
pLV312.3C-Intein (Npu DnaE) - C-terminal (740)SaKKH-BE3 (Rattus norvegicus)Mammalian Expression, AAV, CRISPRpx601 Schwank
jk95CAG:gfp:P2A:myc_NRXN (Mus musculus)AAVpaavCAG-Jx Zador
jk96CAG:mCherry:P2A:HA_NLGN (Mus musculus)AAVpaavCAG-Jx Zador
013LP-pAAV-ANF-657-EmGFP-pAEmGFP (Other)AAVpEMBL83XFlag, HA Wehrens
pAAV-Ef1a-DIO-hBFP-2A-RVG-WPREEF1α-DIO-H2B-tagBFP-Flagx3-T2Am-cB19GMammalian Expression, AAVUnknown Callaway
pAAV-EnhancedSynapsin-DIO-TVA950-EYFP-WPREeSyn-DIO-TVA950:YFPMammalian Expression, AAVUnknown Callaway
014LP-pAAV-ANF-657- Cre-pACre (Other)AAVpEMBL8CRE Wehrens
011LP-pAAV-TNT4-EmGFP-pAEmGFP (Other)AAVpEMBL83XFlag, HA Wehrens
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)N-terminal fragment of SpyCas9 (Other)Mammalian Expression, AAV, CRISPRpZac2.1split-intein, SV40-NLS Niopek
AAV Intein-C-SpyCas9, CMV-AcrIIA4-scaffold (2xBsmBI sites)C-terminal fragment of SpyCas9 (Other)Mammalian Expression, AAV, CRISPRpZac2.1split-intein Niopek
AAV Intein-C-SpyCas9, CMV-AcrIIA4-2xmiR-122 target sitesC-terminal fragment of SpyCas9 (Other)Mammalian Expression, AAV, CRISPRpZac2.1split-intein Niopek
pAAV-RSV-GFP-U6-Rosa26 gRNA (SpyCas9 scaffold) Rosa26 gRNA (SpCas9 scaffold) (Other)Mammalian Expression, AAV, CRISPRscAAV Niopek
AAV CMV-driven AcrIIA4-scaffold (2xBsmBI sites)AcrIIA4 (Other)Mammalian Expression, AAV, CRISPRscAAVFLAG Niopek
AAV CMV-driven AcrIIA4-2xmiR-122 target sitesAcrIIA4-2xmiR-122 binding sites (Other)Mammalian Expression, AAV, CRISPRscAAVFLAG Niopek
AAV CMV-driven AcrIIA4-2xmiR-1 target sitesAcrIIA4-2xmiR-1 binding sites (Other)Mammalian Expression, AAV, CRISPRscAAVFLAG Niopek
AAV CMV-driven AcrIIC1-scaffold (2xBsmBI sites)AcrIIC1 (Other)Mammalian Expression, AAV, CRISPRscAAV Niopek
AAV CMV-driven AcrIIC3-scaffold (2xBsmBI sites)AcrIIC3 (Other)Mammalian Expression, AAV, CRISPRscAAV Niopek
AAV CMV-driven AcrIIC1-2xmiR-122 target sitesAcrIIC1-2xmiR-122 binding sites (Other)Mammalian Expression, AAV, CRISPRscAAV Niopek
AAV CMV-driven AcrIIC3-2xmiR-122 target sitesAcrIIC3-2xmiR-122 binding sites (Other)Mammalian Expression, AAV, CRISPRscAAV Niopek
AAV_hSyn_IlmolIlmol (Other)Mammalian Expression, AAVpAAV Baker
pAAV-Linker-hSyn::mCherry.3xFLAG-WPREAAVpAAVmCherry.3XFLAG Freudenberg
pAAV-U6-hSyn::mCherry.3xFLAG-WPREAAVpAAVmCherry.3XFLAG Freudenberg
pAAV-U6-Diras2_1-hSyn::mCherry.3xFLAG-WPREDiras2 shRNA (Mus musculus)AAV, RNAipAAVmCherry.3XFLAG Freudenberg
pAAV-U6-Diras2_2-hSyn::mCherry.3xFLAG-WPREDiras2 shRNA (Mus musculus)AAV, RNAipAAVmCherry.3XFLAG Freudenberg
pAAV-U6-Scrambled-hSyn::mCherry.3xFLAG-WPREScrambled shRNAAAV, RNAipAAVmCherry.3XFLAG Freudenberg
pAAV.pU1a-SpCas9SpCas9 (Synthetic)Mammalian ExpressionpAAVHA Gao
pAAVsc.U6-sgFah.CMV/CB-EGFPsgFah (Synthetic)Mammalian Expression, AAVpAAVsc Gao
pAAVsc.U6-sgFah.Intron9.CMV/CB-EGFPsgFah.intron9 (Synthetic)Mammalian Expression, AAVpAAVsc Gao
pAAVsc.U6-sgAspa.CMV/CB-EGFPsgAspa (Synthetic)Mammalian Expression, AAVpAAVsc Gao
pAAVsc.U6-sgIdua.CMV/CB-EGFPsgIdua (Synthetic)Mammalian Expression, AAVpAAVsc Gao
pAAVsc.U6-sgGTTG.CMV/CB-GlucsgGTTG (Synthetic)Mammalian Expression, AAVpAAVsc Gao
pOTTC1484 - pAAV SYN1 HA-hM4D(Gi)HA-tagged hM4D(Gi) (Homo sapiens)Mammalian Expression, AAVpOTTC1479 - pAAV SYN1 iRFP-FLAGHA Richie
pOTTC1596 - pAAV SYN1 HA-hM3D(Gq)HA-tagged hM3D(Gq) (Homo sapiens)Mammalian Expression, AAVpOTTC1479 - pAAV SYN1 iRFP-FLAGHA Richie
pAAV-Dlx5/6-Chronos-eGFP-p2a-nls-mScarletblue-absorbing channelrhodopsin Chronos with eGFP and nls-mScarlet (Synthetic)AAVpAAV Prigge
pAAV-EF1a-fDIO-CreNLS-CRE-HA (Synthetic)Mammalian Expression, AAVpAAV-Ef1a-fDIO EYFP (Addgene #55641)3xHA, SV40-NLS Engel
pAAV-hSyn-GACh2.0GPCR activation based ACh sensor GACh2.0 (Homo sapiens)AAVpAAV vector Li
pAAV-EF1α1.1-ChrimsonR-GFPChrimsonR-GFP (Other)Mammalian Expression, AAVpAAV-EF1α1.1 Chrimson K176R mutant GFP Boyden
pAAV-EF1α1.1-ChrimsonR-tdTomatoChrimsonR-tdTomato (Synthetic)Mammalian Expression, AAVpAAV-EF1α1.1 Chrimson K176R mutant tdTomato (codon diversified version) Boyden
pAAV-EF1α1.1-Chronos-GFPChronos-GFP (Synthetic)Mammalian Expression, AAVpAAV-EF1α1.1GFP Boyden
pAAV-EF1α1.1-Chronos-tdTomatoChronos-tdTomato (Synthetic)Mammalian Expression, AAVpAAV-EF1α1.1tdTomato Boyden
pAAV-EF1α1.1-GFPGFP (Synthetic)Mammalian Expression, AAVpAAV-EF1α1.1NA Boyden
pAAV-EF1α1.1-tdTomatotdTomato (Synthetic)Mammalian Expression, AAVpAAV-EF1α1.1NA Boyden
pAAV-CAG-Flex-Rev-3xGFP3x GFPAAVpAAV each GFP has unique nt sequence Ritola
pAAV-CAG-Flex-Rev-TdTomatoTdTomatoAAVpAAV Ritola
pAAV-Syn-iCreiCreAAVpAAV Ritola
pAAV-GFAP104-melanopsin-mCherrymelanopsin-mCherry (Synthetic)Mammalian Expression, AAVpAAV-GFAP104mCherry Boyden
pSaCas9-1xms2-2x3’UTRSaCas9-MS2-HBB 3' UTR (Other)Mammalian Expression, AAVpX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA Lu
pSaCas9-1xPP7-2x3'UTRSaCas9-PP7-HBB 3' UTR (Other)Mammalian Expression, AAVpX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA Lu
pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLIDSyph-GFP-myc-BoNT/B(1-146)-iLID (Rattus norvegicus)Mammalian Expression, AAVpAAV hSynGFP Kennedy
pAAV hSyn mCh-IRES-BoNT/B(1-146)-iLIDmCh-IRES-BoNT/B(1-146)-iLID (Synthetic)Mammalian Expression, AAVpAAV hSyn iLID contains long lived V416I mutation mCh Kennedy
pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A)mCh-IRES-SspB(milli)-BoNT/B(147-441)Mammalian Expression, AAVpAAV hSyn SspB contains A58V,R73Q "milli" mutations, BoNT/B contains Y365A mutation mCh Kennedy
pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A)mCh-IRES-SspB(micro)-BoNT/B(147-441) (Synthetic)Mammalian Expression, AAVpAAV hSyn SspB contains R73Q "micro" mutation, BoNT/B contains Y365A mutation mCh Kennedy
pAAV-GFAP104-ChromeQ-mCherryChromeQ-mCherry (Other)Mammalian Expression, AAVpAAV-GFAP104 Channelrhodopsin-2 (ChR2) with mutations A71S/ E90A/H114G/R115S mCherry Boyden
pAAV-GFAP104-ChromeT-mCherryChromeT-mCherry (Other)Mammalian Expression, AAVpAAV-GFAP104 Channelrhodopsin-2 (ChR2) with mutations A71S/ E90A/H114G mCherry Boyden
pAAV-hSyn-GRAB_NE1mGPCR activation based NE sensor GRAB_NE1m (Homo sapiens)AAVpAAV vector contains a glycine-to-threonine mutation at position C1 Li
pAAV-hSyn-GRAB_NE1hGPCR activation based NE sensor GRAB_NE1h (Homo sapiens)AAVpAAV vector Li
pAAV-hSyn-GRAB_NEmutGPCR activation based NE control sensor GRAB_NEmut (Homo sapiens)AAVpAAV vector Li
pAAV-Syn-ChromeT-GFPChromeT-GFP (Other)Mammalian Expression, AAVpAAV-Syn Channelrhodopsin-2 (ChR2) with mutations A71S/ E90A/H114G GFP Boyden
pAAV-Syn-ChromeQ-GFPChromeQ-GFP (Other)Mammalian Expression, AAVpAAV-Syn Channelrhodopsin-2 (ChR2) with mutations A71S/ E90A/H114G/R115S GFP Boyden
pAAV-Syn-FLEX-rc [ArchT-tdTomato]ArchT-tdTomato (Synthetic)Mammalian Expression, AAVAAV-Syn-FLEXtdTomato Boyden
pAAV-CAG-mNeonGreenmNeonGreen (Synthetic)Mammalian Expression, AAV741 Codon usage was optimized for Homo Sapiens Tsoulfas
pAAV-UbC-mNeonGreenmNeonGreen (Synthetic)Mammalian Expression, AAVpAAV-UbC Codon usage was optimized for Homo Sapiens Tsoulfas
pX330-NL-DHFR-SpCas9NL-DHFR-SpCas9 (Other)Mammalian Expression, AAVpX330Destabilized domain of E.coli dihydrofolate reductase, Destabilized domain of E.coli dihydrofolate reductase (internal loop at amino acid 231) Choudhary
pX330-NLC-DHFR-SpCas9NLC-DHFR-SpCas9 (Other)Mammalian Expression, AAVpX330Destabilized domain of E.coli dihydrofolate reductase, Destabilized domain of E.coli dihydrofolate reductase (internal loop at amino acid 231) Choudhary
pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40Soma-localized ChrimsonR (Mus musculus)Mammalian Expression, AAVpcDNAmRuby2 Harvey
pAAV-EF1a-DIO-C1V1(t/t)-mRuby2-KV2.1-WPRE-SV40Soma-localized C1V1(t/t) (Mus musculus)Mammalian Expression, AAVpcDNAmRuby2 Harvey
pAAV-EF1a-FDIO-ArchT-GFPArchT (Other)Mammalian Expression, AAV ; Flp/FrtAAVEGFP Dupret
pAAV-EF1a-DIO-FLPo-MycFLPo (Saccharomyces cerevisiae)Mammalian Expression, AAV, Cre/LoxpAAV-Ef1a-DIOmyc tag Dupret
pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1C1V1 (Mus musculus)Mammalian Expression, AAVpcDNAmScarlet Harvey
pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1ChrimsonR (Mus musculus)Mammalian Expression, AAVpcDNAmScarlet Harvey
SL016: AAV-CAG-FLEX-CheRiff-GFPCheRiff-GFP (Synthetic)AAV, Cre/LoxAAV-CAG-FLEXGFP Cohen
pAAV-FLEX-SaCas9-U6-sgRNAgRNA scaffold (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgRNAgRNA scaffold (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgSlc17a7Slc17a7 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgSlc17a6Slc17a6 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgSlc17a8Slc17a8 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgSlc18a2Slc18a2 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgGrin2aGrin2a (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgGrin2bGrin2b (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgGrin1Grin1 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgGria1Gria1 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgGria2Gria2 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgGria3Gria3 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgGabrg1Gabrg1 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgGabrg2Gabrg2 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEX-SaCas9-U6-sgGabrg3Gabrg3 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a7Slc17a7 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a6Slc17a6 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a8Slc17a8 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgSlc18a2Slc18a2 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgGrin2aGrin2a (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgGrin2bGrin2b (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgGrin1Grin1 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgGria1Gria1 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgGria2Gria2 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgGria3Gria3 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgGabrg1Gabrg1 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgGabrg2Gabrg2 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pAAV-FLEXfrt-SaCas9-U6-sgGabrg3Gabrg3 (Mus musculus)Mouse Targeting, AAV, CRISPRpX601 Zweifel
pOTTC1740 - pAAV SYN1 DIO HA-hM4D(Gi)HA-tagged hM4D(Gi) (Homo sapiens)Mammalian Expression, AAV, Cre/LoxpOTTC901 - pAAV SYN1 DIO GIRK4-MycHA Richie
pOTTC1761 - pAAV SYN1 DIO HA-hM3D(Gq)HA-tagged hM3D(Gq) (Homo sapiens)Mammalian Expression, AAV, Cre/LoxpOTTC901 - pAAV SYN1 DIO GIRK4-MycHA Richie
pAAV-HA-β2AR-NNES-NanoLuc-15aa linker-AsLOV2(V416L)HA-β2AR-NNES-NanoLuc-15aa linker-AsLOV2(V416L)Mammalian Expression, AAVpAAVHA Ting
pAAV-gLuc sp-NanoLuc-HA-β2AR-NNES-AsLOV2(V416L)gLuc sp-NanoLuc-HA-β2AR-NNES-AsLOV2(V416L) (Synthetic)Mammalian Expression, AAVpAAVHA Ting
pAAV-mCherry-GS linker-Zdk1mCherry-GS linker-Zdk1 (Synthetic)Mammalian Expression, AAVpAAV Ting
pAAV-DRD1-NNES-eLOV-TEVcs-Flag-Gal4-V5DRD1-NNES-eLOV-TEVcs-Flag-Gal4-V5 (Synthetic)Mammalian Expression, AAVpAAVFlag, V5 Ting
pAAV-NanoLuc-15aa linker-βarrestin2-HA-GS linker-TEVpNanoLuc-15aa linker-βarrestin2-HA-GS linker-TEVp (Synthetic)Mammalian Expression, AAVpAAVHA Ting
pAAV-IgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLucIgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLuc (Synthetic)Mammalian Expression, AAVpAAVHA Ting
pAAV-gLuc sp-GS linker-HiBit-Flag-oβ2AR-TS-NNES-eLOV-TEVcs-Flag-Gal4-V5gLuc sp-GS linker-HiBit-Flag-oβ2AR-TS-NNES-eLOV-TEVcs-Flag-Gal4-V5 (Synthetic)Mammalian Expression, AAVpAAVFlag, V5 Ting
pAAV-NanoLuc-15aa linker-βarrestin2-no HA-GS linker-TEVpNanoLuc-15aa linker-βarrestin2-no HA-GS linker-TEVp (Synthetic)Mammalian Expression, AAVpAAV Ting
pAAV-β2AR-NNES-NanoLuc-eLOV-TEVcs-Flag-Gal4-V5β2AR-NNES-NanoLuc-eLOV-TEVcs-Flag-Gal4-V5 (Synthetic)Mammalian Expression, AAVpAAVFlag, V5 Ting
pAAV-CAG-dLight1.3bdLight1.3b (Synthetic)Mammalian Expression, AAVpAAV-CAGFlag tag Tian
136_pAAV-ProA1-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
137_pAAV-ProA3-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
155_pAAV-ProA4-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
105_pAAV-ProC16-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
107_pAAV-ProC17-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
108_pAAV-ProC18-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
114_pAAV-ProC22-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
115_pAAV-ProC23-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
116_pAAV-ProC24-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
119_pAAV-ProC25-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
120_pAAV-ProC26-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
152_pAAV-ProC30-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
153_pAAV-ProC31-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
167_pAAV-ProC34-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
168_pAAV-ProC35-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
171_pAAV-ProC36-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
172_pAAV-ProC37-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
173_pAAV-ProC38-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
174_pAAV-ProC39-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
37_pAAV-ProC40-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
42_pAAV-ProC41-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
13_pAAV-ProC71-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
198_pAAV-ProD1-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
157_pAAV-ProD2-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
159_pAAV-ProD3-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
161_pAAV-ProD5-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
177_pAAV-ProD8-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
178_pAAV-ProD9-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
179_pAAV-ProD10-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
180_pAAV-ProD11-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
181_pAAV-ProD12-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
182_pAAV-ProD13-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
183_pAAV-ProD14-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
184_pAAV-ProD15-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
185_pAAV-ProD16-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
206_pAAV-ProD17-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
209_pAAV-ProD18-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
210_pAAV-ProD19-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
211_pAAV-ProD20-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
212_pAAV-ProD21-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
214_pAAV-ProD22-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
215_pAAV-ProD23-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
216_pAAV-ProD24-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
217_pAAV-ProD25-CatCh-GFP-WPRECatCh-GFP (Synthetic)AAVpAAV Roska
pAAV2-ProC3-Cre/mCherryCre-2A-mCherry (Synthetic)AAVpAAV Roska
pAAV-Ef1a-sCreDIO hChR2(H134R)-eYFP 2.0hChR2(H134R)-eYFP (Other)AAVpAAV H134R eYFP Deisseroth
pAAV-Ef1a-vCreDIO hChR2(H134R)-eYFP 2.0hChR2(H134R)-eYFP (Other)AAVpAAV H134R eYFP Deisseroth
AAV-Flex-rev-GFPFANACfullWTeGFP N-terminal fused to FMRFamide gate sodium channel (Other)AAVAddgene plasmid 18917 McQuiston
pAAV-Syn-SomArchonSomArchon (Synthetic)Mammalian Expression, AAVpAAV-SynGFP Boyden
pAAV-CaMKII-SomArchonSomArchon (Synthetic)Mammalian Expression, AAVpAAV-CaMKIIGFP Boyden
pAAV-CAG-FLEX-SomArchonSomArchon (Synthetic)Mammalian Expression, AAVpAAV-FLEXGFP Boyden
pAAV-Syn-SomArchon-P2A-CoChR-Kv2.1SomArchon-P2A-CoChR-Kv2.1 (Synthetic)Mammalian Expression, AAVpAAV-SynGFP Boyden
pAAV-CAG-DIO-ChR2(H134R)-eYFPChannelrhodopsin-2 (Other)Mammalian Expression, AAVpAAV Humanized ChR2 gene with histidine 134 changed to arginine (H134R), to achieve higher currents eYFP (C terminal on insert) Gradinaru
pAAV-CAG-DIO-tTAtTAMammalian Expression, AAVpAAV *(see below) Gradinaru
pAAV-TRE-DIO-tdTomato-ftdTomato-fMammalian Expression, AAVpAAVfarnesylation signal from c-Ha-Ras Gradinaru
pAAV-hSyn-mCherry-WPREmCherry (Other)AAVpAAV Freudenberg
pAAV-hSyn-mCherry.3xFLAG-WPREmCherry (Other)AAVpAAV3xFLAG Freudenberg
pAAV-hSyn-3xFLAG-WPRE3xFLAG (Synthetic)AAVpAAV Freudenberg
pAAV-hSyn-mCherry.3xFLAG.NOS1AP-WPRENos1ap (Mus musculus)AAVpAAV3xFLAG, mCherry Freudenberg
pAAV-hSyn-mCherry.3xFLAG.NOS1APΔC20-WPRENos1ap (Mus musculus)AAVpAAV deleted the c-terminal 20 amino acids 3xFLAG, mCherry Freudenberg
pAAV-hSyn-mCherry.3xFLAG.NOS1APC20-WPRENos1ap (Mus musculus)AAVpAAV C-terminal 20 amino acids only 3xFLAG, mCherry Freudenberg
pAAV-hSyn-mCherry.3xFLAG.NOS1AP-S-WPRENos1ap (Homo sapiens)AAVpAAV constructed by blunt end fusion of the 5’ 51 nucleotides (starting from the ATG) of the human NOS1AP (short isoform) ORF, to the 3’ 590 nucleotides of the mouse NOS1AP 3xFLAG, mCherry Freudenberg
pAAV-hSyn-NOS-IN133.3xFLAG.mCherry-WPRENos1 (Mus musculus)AAVpAAV Amino acids 1-133 only 3xFLAG, mCherry Freudenberg
pAAV-hSyn-NOS-IN133.3xFLAG-WPRENos1 (Mus musculus)AAVpAAV Amino acids 1-133 only 3xFLAG Freudenberg
Addgene Blugene icon

Do you have suggestions for other plasmids that should be added to this list?

Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource!