pC0038-CMV-Cluciferase(W85X)-polyA EF1a-G-luciferase-polyA
(Plasmid #103848)

• Purpose: Expresses mutated Cypridinia luciferase (Cluc-W85X) under the control of the CMV promoter and Gaussia luciferase (Gluc) under the control of the EF1alpha promoter. Useful for evaluating RNA editing.
• Depositing Lab: Feng Zhang
• Depositing Organization: Broad Institute
  Located in the United States of America
• Publication: Cox et al Science. 2017 Oct 25. pii: eaaq0180. doi: 10.1126/science.aaq0180.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 2686
• Total vector size (bp): 6957
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cypridinia luciferase
• Alt name: Cluc
• Species: Cyridina noctiluca
• Insert Size (bp): 1659
• Mutation: Mutated W85 (TGG) to stop codon (TAG).
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Gene/Insert 2

• Gene/Insert name: Gaussia luciferase
• Alt name: Gluc
• Species: Gaussia princeps
• Insert Size (bp): 555
• Promoter: EF1alpha

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggttcattctcaagcctcagaca

Resource Information

• A portion of this plasmid was derived from a plasmid made by: From NEB plasmids pCMV-CLuc 2 Control Plasmid, and pCMV-GLuc Control Plasmid.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Benchling link: https://benchling.com/s/seq-W2n4wX4vSUuslGzYgYO5