pEGFP Kind2 S666A
(Plasmid
#105308)
-
PurposeTo study altered downstream functions of phospholylation-site null kindlin2
-
Depositing Lab
-
Depositing OrganizationNational Institute of Dental and Craniofacial Research (NIDCR)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105308 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-NV
-
Backbone manufacturermodified pEGFP-N1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKindlin2
-
Alt nameFERMT2
-
Alt namefermitin family member 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2100
-
MutationS666A
-
GenBank IDNM_006832
-
Entrez GeneFERMT2 (a.k.a. KIND2, MIG2, PLEKHC1, UNC112, UNC112B, mig-2)
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer TCCTGAATGTTTGGTGTCTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutation in Kindlin2 was introduced by using site-directed mutagenesis (Stratagene)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP Kind2 S666A was a gift from Kenneth Yamada (Addgene plasmid # 105308 ; http://n2t.net/addgene:105308 ; RRID:Addgene_105308) -
For your References section:
Dense fibrillar collagen is a potent inducer of invadopodia via a specific signaling network. Artym VV, Swatkoski S, Matsumoto K, Campbell CB, Petrie RJ, Dimitriadis EK, Li X, Mueller SC, Bugge TH, Gucek M, Yamada KM. J Cell Biol. 2015 Feb 2;208(3):331-50. doi: 10.1083/jcb.201405099. 10.1083/jcb.201405099 PubMed 25646088