pmKikGR Actin
(Plasmid
#105315)
-
PurposePhotoconvertable cytoskeletal protein actin to study kinetics or dynamics
-
Depositing Lab
-
Depositing OrganizationNational Institute of Dental and Craniofacial Research (NIDCR)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 105315-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 105315-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmKikGRNB
-
Backbone manufacturermodified pEGFP-C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameactin beta
-
Alt nameACTB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1100
-
Entrez GeneACTB (a.k.a. BKRNS, BNS, BRWS1, CSMH, DDS1, PS1TP5BP1, THC8)
-
Tag
/ Fusion Protein
- KikGR (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (unknown if destroyed)
- 3′ cloning site Xba1 (unknown if destroyed)
- 5′ sequencing primer TCCAGTTGCCAGACTATCAC
- 3′ sequencing primer ATGTTTCAGGTTCAGGGGGAGGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pmKikGR was constructed by inserting sequence corresponding to mKikGR with Kozak sequence to replace EGFP in Nhe1 /BglII sites of pEGFP NBC1. mKikGR was from Dr. Atsushi Miyawaki (Riken BSI).
DNA (Catalog # 105315-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 105315-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmKikGR Actin was a gift from Kenneth Yamada (Addgene plasmid # 105315 ; http://n2t.net/addgene:105315 ; RRID:Addgene_105315) -
For your References section:
Micro-environmental control of cell migration--myosin IIA is required for efficient migration in fibrillar environments through control of cell adhesion dynamics. Doyle AD, Kutys ML, Conti MA, Matsumoto K, Adelstein RS, Yamada KM. J Cell Sci. 2012 May 1;125(Pt 9):2244-56. doi: 10.1242/jcs.098806. Epub 2012 Feb 10. 10.1242/jcs.098806 PubMed 22328520