TRIN-shREN
(Plasmid
#105586)
-
PurposeDox-inducible mir30 shREN (control shRNA)/dsRED expression with Venus marker and Neo resistance
-
Depositing Lab
-
Depositing OrganizationCold Spring Harbor Laboratory
Located in United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105586 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneTRE-dsRED/mir30-shRNA-PGK-venus-IRES-neo
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecontrol shRNA targeting luciferase
-
gRNA/shRNA sequenceTGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA
-
SpeciesM. musculus (mouse)
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer TGT TTG AAT GAG GCT TCA GTA C
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRIN-shREN was a gift from Christopher Vakoc (Addgene plasmid # 105586 ; http://n2t.net/addgene:105586 ; RRID:Addgene_105586) -
For your References section:
A TFIID-SAGA Perturbation that Targets MYB and Suppresses Acute Myeloid Leukemia. Xu Y, Milazzo JP, Somerville TDD, Tarumoto Y, Huang YH, Ostrander EL, Wilkinson JE, Challen GA, Vakoc CR. Cancer Cell. 2018 Jan 8;33(1):13-28.e8. doi: 10.1016/j.ccell.2017.12.002. 10.1016/j.ccell.2017.12.002 PubMed 29316427
Map uploaded by the depositor.