-
Purposelentiviral CMV driven tdTomato-P2A-T2A, Blasticidin selectable
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti6.3/TO/V5-DEST
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 9351
-
Modifications to backbonepUltra-Chili sTomato and P2A-T2A MCS cloned into pLenti 6.3 (through in-fusion cloning, linearized through PstI and SalI digestion, restriction sites maintained)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedTomato
-
SpeciesSynthetic
-
Insert Size (bp)702
- Promoter CMV
-
Tag
/ Fusion Protein
- T2A, P2A
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TTGGTCACCTTCAGCTTGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byinsert derived from pUltra-Chili (Plasmid #48687)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti- V6.3 Ultra-Chili was a gift from Ewa Snaar-Jagalska (Addgene plasmid # 106173 ; http://n2t.net/addgene:106173 ; RRID:Addgene_106173)