pLKO.1P shSHMT2
(Plasmid
#106319)
-
PurposeExpress shRNA targeting SHMT2
-
Depositing Lab
-
Depositing OrganizationNYU Grossman School of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106319 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLKO_TRC005
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 7466
- Total vector size (bp) 7518
-
Vector typeLentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA targeting SHMT2
-
gRNA/shRNA sequenceCCGGAGAGTTGTGGACTTTAT
-
SpeciesH. sapiens (human)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe RNAi Consortium
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TRCN0000238795
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1P shSHMT2 was a gift from Richard Possemato (Addgene plasmid # 106319 ; http://n2t.net/addgene:106319 ; RRID:Addgene_106319) -
For your References section:
Serine Catabolism by SHMT2 Is Required for Proper Mitochondrial Translation Initiation and Maintenance of Formylmethionyl-tRNAs. Minton DR, Nam M, McLaughlin DJ, Shin J, Bayraktar EC, Alvarez SW, Sviderskiy VO, Papagiannakopoulos T, Sabatini DM, Birsoy K, Possemato R. Mol Cell. 2018 Feb 15;69(4):610-621.e5. doi: 10.1016/j.molcel.2018.01.024. 10.1016/j.molcel.2018.01.024 PubMed 29452640