Skip to main content

K785R Smarca4-V5 IRES-puro
(Plasmid #107059)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107059 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pRRL
  • Total vector size (bp) 14055
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
  • Species
    M. musculus (mouse)
  • Mutation
    K785R
  • Entrez Gene
    Smarca4 (a.k.a. BAF190A, Brg1, HP1-BP72, SNF2beta, SW1/SNF, b2b508.1Clo, b2b692Clo)
  • Promoter CAG
  • Tags / Fusion Proteins
    • V5 (C terminal on insert)
    • IRES-puroR (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K785R Smarca4-V5 IRES-puro was a gift from Jerry Crabtree & Courtney Hodges (Addgene plasmid # 107059 ; http://n2t.net/addgene:107059 ; RRID:Addgene_107059)
  • For your References section:

    Dominant-negative SMARCA4 mutants alter the accessibility landscape of tissue-unrestricted enhancers. Hodges HC, Stanton BZ, Cermakova K, Chang CY, Miller EL, Kirkland JG, Ku WL, Veverka V, Zhao K, Crabtree GR. Nat Struct Mol Biol. 2018 Jan;25(1):61-72. doi: 10.1038/s41594-017-0007-3. Epub 2017 Dec 11. 10.1038/s41594-017-0007-3 [pii] PubMed 29323272