FoxFTVC+bpFOG_MRAS-G22V
(Plasmid
#107521)
-
PurposeConstitutive activation of FGF/MAPK pathway by M-Ras-G22V mutant
-
Depositing Lab
-
Depositing OrganizationNew York University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCESA
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 3759
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameM-Ras protein
-
Alt namesmall GTPase
-
Insert Size (bp)600
-
Mutationchanged Glycine 22 to Valine
-
GenBank IDXP_002121859.1
- Promoter TVC-specific FoxF enhancer (FoxFTVC+bpFOG)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer cattaacctataaaaataggcgtatca
- 3′ sequencing primer ggatttccttacgcgaaatacg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FoxFTVC+bpFOG_MRAS-G22V was a gift from Lionel Christiaen (Addgene plasmid # 107521 ; http://n2t.net/addgene:107521 ; RRID:Addgene_107521) -
For your References section:
An FGF-driven feed-forward circuit patterns the cardiopharyngeal mesoderm in space and time. Razy-Krajka F, Gravez B, Kaplan N, Racioppi C, Wang W, Christiaen L. Elife. 2018 Feb 6;7. pii: 29656. doi: 10.7554/eLife.29656. PubMed 29431097