pYES2-gRNA-hyg-MCS
(Plasmid #107734)

• Purpose: E. coli-S. cerevisiae shuttle plasmid harbors gRNA expression cassettes targeting S. cerevisiae chromosomal X-3 site (HXK1 gene). Can function as a gRNA expression empty backbone plasmid.
• Depositing Lab: Sheng Yang
• Publication: Wang et al Biotechnol Bioeng. 2018 Sep 10. doi: 10.1002/bit.26827.

Backbone

• Vector backbone: pYES2
• Backbone size w/o insert (bp): 5856
• Total vector size (bp): 6244
• Vector type: Yeast Expression, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: X-3 site gRNA expression cassettes
• Alt name: HXK1
• Alt name: YFR053C
• gRNA/shRNA sequence: X-3 site gRNA expression cassettes, aatttcatccatcaattcct
• Species: S. cerevisiae (budding yeast)
• GenBank ID: 850614
• Promoter: SNR52p

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: NA

Resource Information

• Supplemental Documents:
  • pYES2-gRNA-hyg-MCS.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pYES2-gRNA-hyg-MCS is an E. coli-S. cerevisiae shuttle plasmid which harbors gRNA expression cassettes targeting S. cerevisiae chromosomal X-3 site gRNA (HXK1 gene).

However, it can function as an empty gRNA expression backbone plasmid because the existing gRNA expression cassette can be easily replaced with conventional restriction enzyme digestion-ligation method. Moreover, multiple gRNA expression cassettes can be loaded in the MCS.