Skip to main content

pYES2-gRNA-hyg-MCS
(Plasmid #107734)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107734 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pYES2
  • Backbone size w/o insert (bp) 5856
  • Total vector size (bp) 6244
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    X-3 site gRNA expression cassettes
  • Alt name
    HXK1
  • Alt name
    YFR053C
  • gRNA/shRNA sequence
    X-3 site gRNA expression cassettes, aatttcatccatcaattcct
  • Species
    S. cerevisiae (budding yeast)
  • GenBank ID
    850614
  • Promoter SNR52p

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pYES2-gRNA-hyg-MCS is an E. coli-S. cerevisiae shuttle plasmid which harbors gRNA expression cassettes targeting S. cerevisiae chromosomal X-3 site gRNA (HXK1 gene).

However, it can function as an empty gRNA expression backbone plasmid because the existing gRNA expression cassette can be easily replaced with conventional restriction enzyme digestion-ligation method. Moreover, multiple gRNA expression cassettes can be loaded in the MCS.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYES2-gRNA-hyg-MCS was a gift from Sheng Yang (Addgene plasmid # 107734 ; http://n2t.net/addgene:107734 ; RRID:Addgene_107734)
  • For your References section:

    Unraveling the genetic basis of fast l-arabinose consumption on top of recombinant xylose-fermenting Saccharomyces cerevisiae. Wang X, Yang J, Yang S, Jiang Y. Biotechnol Bioeng. 2018 Sep 10. doi: 10.1002/bit.26827. 10.1002/bit.26827 PubMed 30199094