Skip to main content

pCMV/myc/ER-αT9ib
(Plasmid #110768)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110768 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pcDNA/myc/ER
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5044
  • Total vector size (bp) 5066
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    intrabody against mouse and human TLR9
  • Alt name
    αT9ib
  • Alt name
    Human/murine TLR9-cross-reactive intrabody
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    738
  • Promoter CMV
  • Tags / Fusion Proteins
    • myc epitope tag (C terminal on backbone)
    • ER retention signal (SEKDEL) (C terminal on backbone)
    • ER signal peptide (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV/myc/ER-αT9ib was a gift from Thomas Böldicke (Addgene plasmid # 110768 ; http://n2t.net/addgene:110768 ; RRID:Addgene_110768)
  • For your References section:

    Molecular cloning and characterization of a novel anti-TLR9 intrabody. Reimer E, Somplatzki S, Zegenhagen D, Hanel S, Fels A, Bollhorst T, Hovest LG, Bauer S, Kirschning CJ, Boldicke T. Cell Mol Biol Lett. 2013 Sep;18(3):433-46. doi: 10.2478/s11658-013-0098-8. Epub 2013 Jul 26. 10.2478/s11658-013-0098-8 PubMed 23893288