pRP(Exp)-CMV> ORF_924bp (Azgp1):T2A:dTomato:IRES:Puro
(Plasmid
#110830)
-
PurposeExpresses zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter where both sequences are separated by a T2A self-cleaving peptide sequence as a result, the dT is not fused with the ZAG protein.
-
Depositing Lab
-
Depositing OrganizationAugusta University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 110830-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 110830-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
-
Backbone manufacturervector builder
- Backbone size w/o insert (bp) 5722
- Total vector size (bp) 6646
-
Vector typenon-viral gene expression vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAZGP1
-
Alt nameZAG-T2A-dT
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)924
-
Entrez GeneAzgp1 (a.k.a. Zag)
- Promoter CMV
-
Tags
/ Fusion Proteins
- dTomato (C terminal on backbone)
- T2A (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ORF_924bp (Azgp1)-reverse primer: CTGAGGCTGAGCTACAACATTG
- 3′ sequencing primer CMV-forward primer: TTGACGCAAATGGGCGGTAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byvector builder
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 110830-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 110830-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRP(Exp)-CMV> ORF_924bp (Azgp1):T2A:dTomato:IRES:Puro was a gift from Ande Satyanarayana (Addgene plasmid # 110830 ; http://n2t.net/addgene:110830 ; RRID:Addgene_110830) -
For your References section:
The tumor secretory factor ZAG promotes white adipose tissue browning and energy wasting. Elattar S, Dimri M, Satyanarayana A. FASEB J. 2018 Mar 23:fj201701465RR. doi: 10.1096/fj.201701465RR. 10.1096/fj.201701465RR PubMed 29570397