pmTurquoise-parkin
(Plasmid
#110945)
-
PurposeExpresses the ubiquitin ligase parkin fused to mTurquoise
-
Depositing Lab
-
Depositing OrganizationETH Zurich (Swiss Federal Institute of Technology)
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 110945-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 110945-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepECFP-C1
- Backbone size w/o insert (bp) 4698
- Total vector size (bp) 6096
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE3 ubiquitin ligase parkin
-
Alt nameparkin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2009
-
Entrez GenePRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
- Promoter CMV
-
Tag
/ Fusion Protein
- mTurquoise2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGAAGCGCGATCACATGG
- 3′ sequencing primer CAGCCATACCACATTTGTAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was assembled using fragments from plasmids #47560 (backbone) and #36204 (mTurquoise2 insert).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 110945-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 110945-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmTurquoise-parkin was a gift from Pablo Rivera-Fuentes (Addgene plasmid # 110945 ; http://n2t.net/addgene:110945 ; RRID:Addgene_110945) -
For your References section:
Disruption of mitochondrial redox homeostasis by enzymatic activation of a trialkylphosphine probe. Nguyen J, Tirla A, Rivera-Fuentes P. Org Biomol Chem. 2021 Mar 28;19(12):2681-2687. doi: 10.1039/d0ob02259d. Epub 2021 Feb 26. 10.1039/d0ob02259d PubMed 33634293